Description :
From Genome Similarity Track
Location :
Scaffold_37:5562- 6671
Sequence
1109 bases(100 bases per row)
CCGATCGGATCAACATGGGTTCCGATCGACCGACCAGATTGACATGGGTACAAATCAGCCGATCAGATCAGCACGTACCACAAATACCGGCACATCGGAG
GTCCAAGAATGTCAGCAATCATGAGATACGCAAGAGAGATGGGGGATAGGCACGTAGTTCTTAATGGATAAACAGAGAGAGATTTTCCTTGTAGCACGCA
AGTGGTCTTCCGAATTCCGGGGAAGGAAGTATATTGGCCTACCCGACGACCGGACAACCACCTGAAGTGACTCAAGCGAGAACGCGGAAGCCCCTGGATA
GCTTGGCCAGGTGCGCTCCCCTTCTCCCTCCAACTCATCAAGACCCCGCCATAGGAGGCGGCAAGCATCGAAAAGGACCCCGTAAAGGACACACCCCGTG
ATCGATCACACACGATCGTCACCCGAACCGACTGCTGCGTGAAGCATATCCGCGTGGCAGCCAACCACCCCCCATACCTGAAGGGCCCTCAAGCCCCAGT
TCTGCCCTGCTCACCACTGACTTTCCTCGCGTGATTACCGGAAGAGCGTAACCCGCCCAAGCCGTCGGGTACACAAGGTGAGCTGTGAGGTCAAGATCCG
CCGGATCAACGGAGTACCCCCTCCGACAGTCGGCAGTCCGGGCAACCGTTGGTGAGTTGCGATCGCGTCAGCAATTTCGTGATCCCGCTCCACCACAATG
GTGCGCGTGCCCGGATCTTCTGGTAACTCACAGGGATTTCACCGTGAGTCTACTCAAGAGGATGTCAAGAGCAAGATAGAACCAGGAATGGAGTCGTCGA
CGGAAGATGGATCGCCGTCGACGGCGCTGAAAGCGCCAGGATCATCTGATCGACAGAGTGCCGGGAGGAGCTCTGACGATGCGAAGGAGGCGGGTTCAGA
AATGGACCTAGAAGAGAAGCCTTACCCCCCTCCCCAGGCCCCTACGGGGGCCCCCGCGGATCACGATGCGAATCGTGATCCGCCGGATGAAGGTCCGACG
GTGAAAACCGAAGGACTTTCATCCACAACTACTCCTCCAACCTCTCGATCGGCACCGAAGAAGAAGTCGAAGACATCGCGCATGAAGATGAAAGCGCCAG
AATCGGATG