Description :
From Genome Similarity Track
Location :
Scaffold_15:55606- 56609
Transcript NameFunction/comments
g3080.t1POM76328.1 Hypothetical protein PHPALM_6441 [Phytophthora palmivora var. palmivora

Sequence
1003 bases(100 bases per row)
TCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCTGCGCTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGA
GACTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGATGGTTCAACTGAATCGTCACCGAGAACTCACGACCAAGC
TGCGGTCGGTGAAGTACCTGCACGTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGCAAGCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTC
GACCGAGGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTACGAACCCTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTC
AGCTTCGCCCGAGCCCAAGTAGCCCGTGGGATCTCCCGCGACAGATCTTTTTTCGACTTTGTGCGGGACGAACCCGACTACCTAACTGCAACAACCAGAC
ACCAAGCAAAAGCGAGGAAGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCCGAATGGTACAGCGAGACGAAGCGAATGGTGTGACCACCG
AAGCTCAGAGTGAGCTGAGAGCCGAGCAATCGAGCAACGAGGTAGACCCTGGCGCTCCAAACGCAGAAGACGTTGACCCTGTGGTTATACAGGAAGAGCG
CCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCTCCGAGGCAAGGAAACAGACCTCAGCTACAGAGCAGCC
AGAGACGCTTGGAAGATGGCCGACAAGTTTGTGCTTAGCGAGGATGGTGTACTGTATTTTCTTGGAACGAACCGTCGGTGGGGCAACGAACGCCGAGAGG
AGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACTACGGAGTTGCCACGACTCGTTGGAAGGTGGCCACCAAGGTATCGGTCGAAC
GTA