Description :
From Genome Similarity Track
Location :
Scaffold_322:5560- 7135
Transcript NameFunction/comments
g10059.t1hypothetical protein

Sequence
1575 bases(100 bases per row)
CCAGTCGATCTGGGGCTGATACCGGGACAGCCATGGTATACCCAGGATACAGTCAAACGCGTAGTTCATCTCAAGCACAATGAAGTTGTCATTGCTGCGG
AAGCCGTCGAACGTATACGGCAACGAGACTTCTCGTCGCGCGACACGGAACGGCTTTCCATCCGCAAGCTTGACAACGACATCACCAGGCACATCACACA
CGGGAACACCCGCGGGTAGGATCGACAGGCATGAAGCGCGGAAGAAATTGTTCGTCGCTCCTGAATCCAGGAGCGCGCGGAGTGGTCGTCGGGCACCGGC
GACATAAAGGCTGACAATAATCAGCCTCGAGTCGCCACTAGCAGTGGTGGCATTAAAGTGTGCATAGAGCACAGGGGGGCTAGGAGGTCGGGCTGCCGCC
GGGGGACCCGGACCTCCGTTCCAGCCAGTAGGTCGCCCCGCACCTACTGGCCCCGGCCGTTTTTTGGCTGTGCGGCCGGAATCCTCTCGTCGGGCGTGAC
GTGCTTCATGTGGGCGAGGATCGGAGCTGGCACGCGGCACACCGCCGCGCGATGACCAGGCTTTCCGCAGCGGAAACAATTCAGCGAGAGGTCATTCTGA
CCACCGCGGCCTCTCCCAGAGGACGACCACCGTCGGTTCTGCGAAGAATCGATCGCATCGATCTCCATTGGCTCGGGTACCGACACCCGAGTCTGCGCAG
GCATCGTCTTGGCGTATGACGACGTCACCAGGTAGTCCTCGCGTAGCGCGAGAGCGAAGGCTTCTTCCAACGTGGCAGGCTCGGCGCGCGTGAGACAGTA
CCGCGTCATACCTTCACACATACCAAACACAAAGACATGGACTTGGGAAGCCATGTCGATCGGCTTCGTGACGATACACGATGCAAGGTGTCGCGTTCTC
TGGACGTAGTCGCGCATGGCCATCTTGCCTTGCTTTAGGGCGAAGAATGTAGCTCGAACGCGCGACTCATCCTGCGGTGGTTCGAAGGCGAGACGCAGGT
CGCTCTGGAGTGCCTCCAGAGTCGGGAACGCGTACTGGTCGACGACAAGTTTGCCGAGAGCCCATTCTTTGGCCTTTCCGGATAAACGGGATAGCAGGAA
GTTCACCTTGGCTGATGGCGCCTCGATTAGCCTCGAGGCGATCGCGATGTCGATCTCTCTGAACCAGCGATTCAGAGGTAGGCGATCAGGACCCTCGCCA
GAATAGGAGGATGTCTCCATCTTGACGGCATTGTTCCTGGACGCATGCGAGGGAGTTGATACTCGCCGTTTTGCTTCGGCGAGCTCGCGGTCCATGAACT
CTTGGATGGCTTGGCGCTGTTGGTCGGGGGTCGCTGAGCTCAGCAGCGACGTGACGACGGTTTCTCCGGACACCGCCGCGAGGCGGTGCAACGCTTGCCA
CTCGATAGACGTGAGATGGGGGAAGGCCGCGTGTTCCAGGGTCATCACTGGAGGTCCGGCGGGCTGGTCTTCACTCATCTCGAACTTGGTCATGGGAAGG
ACTACGAAGTGCTACCAGGTGTAACGGGCCAGGTGAGTGCCCGTCACTAGCTTACACGTAGCGGTGAGGAAGCGT