Description :
From Genome Similarity Track
Location :
Scaffold_1579:556- 8101
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1579-fgenesh-gene-0.0Copper-transporting ATPase
Pytiw_DAOMBR242034maker-piw_contig_1579-snap-gene-0.2Adenylate kinase domain-containing protein 1

Sequence
7545 bases(100 bases per row)
AACCCTGTCGAGAGCGAGCTCGTCACGGGACTGAGCTACAAGGACGCGATCGGGGTCTTGTGCGCGACGCCGATCGTGTTCATCGTCGCGTATCCAATTC
ACGAGAGCGCGTTCCTGGCGATGCGCTACGGCTCGCGCGTGACCATGGACGTGCTCATCTCGCTCAGCTCGGTTGCGGCCTACACGTTCTCGCTCGTGAC
GGTGACCATGGGCGTTTTTGCCGTGAACCCGGAGGGCCGCTCGGAGACGTTCTTTGAAGTCACGGCGCTGCTCGTGACGCTCATCCTCGTCGGGCGGTAC
ATTGAGAAGATCGTCAAGGCCAAGGCGTCCAACAGTGTTGACGCGCTCTTGCGCATCCAGGCCAAGACTGCGATCCTACTGGAGAGCAACTCGGGGATTG
TGAACGCCAGCAGGAGCATGGACAAGTCGCTCAAGGAGTCGTACATTGACGTGATCCTCGTCGAGCGTGATGATCTGCTCAAGGTGCTGCCGGGCACGCG
CATCCCCACAGACGGCGTCGTGGTCGAGGGCGCGAGCACGGTGGACGAGTCCATGGTCACAGGCGAGTCCCGGAAAGTGGCCAAGGAGCCCGGGTCCATT
GTCATTGGCGGCACGATCAACTCGCACGGCGTGCTCGTCATGCGCGTGACGCACACGATCACAGAGTCCATGCTCGCGCGCATCGTGAACCTCGTCGACG
AGGCGCAGTCATCCAAGTGCGTGAGCCAGAGCGTGGCCGACGTTGTCGCATCCTACTTCACGACGTTCATCATCTCGATCTCGGTCATCATGTTCTTTGT
CTGGTACCACTTGGCAAAGATCGGCGAAGTCGGGACCCACGGCTGGGCGCCTTTCCCGTTTGCGCTGCGCTTTGCGATCACGATCCTCGTGATCAGCTGT
CCATGTGCGATCAGCCTCGCGGTGCCCACTGCGATCATGGTTGCGACGACGATCGGGTCCCAGTTTGGCGTGCTCTTCAAAGGCGGCTTTGCCATTGAGG
CCCTCGAGAAAGTGGACGTGGTTATGTTTGACAAAACGGGGACGCTCACGAACGGCACGCTCGCCGTGGTGGACGCGGCGCTGCCTTCCAGTAGTGACAG
CCCCATGAGTATCCGACAGTTGTGGAGCTACATTGCCGCGGCGGAGAAGAACAGCGAGCATGCGATCGCGAGAGGGCTCGTCGCGTATGCGCGCTCGATT
AACGCCCCCGAGGTCGCAGCTGCCAAGTTTGACTCGGTCCCAGGCTGTGGTGTCAAGGCAGTTGTGAGCGGGAACAACGTGAGCGTGGGCTCGTTCAAGT
GGATGCAAGACGTGCTCAAGGTCTCCGTTCCTGTGGACCTGCACATGGCCAACAGCAAGTTCCAGCAGCGCGGATGCGTCGTGATCTGCGTTGCTGTCAA
CGGCGAACTGGCGAGCGTTGTCGCTCTTCGCGACACGCCGCGGCCTGAGGCGCGACTCGTGATCGAGCAGCTCAAGCGCCAGAAGATACAGACGTGGATC
GTCACGGGCGACCAGCGCGAGACCGCACTATCTATCGCCGAGATGCTCGGCATCCCCGAGTTCCTGGTCATCGCGGACGCTTTGCCGCACCAAAAGGTCG
ACAAGGTGCGTCTGCTGCAGAGTATTGGCAAGAATGTGGCGTTCGTGGGCGACGGCGTGAACGACGGACCGGCGCTGGCCATGGCAAACGTGGGCATCGC
CGTGGGCGCTGGCACGGACGTGGCGCTCGAGTCCGCCGACCTGGTGCTCGTGAAGGACGATTTGCGTGACCTGCTGAACGCGATCGACCTCTCGCGGGCA
GCCAACAGGATGATCAGGTGGAATTTTTCGTGGGCGTTCATGTACAACGCGCTCATGATGCCGCTGGCATGCGGGGCGCTGTACCCGTTCTTTGGGATTT
CCATCCCGCCAGCGCTCGCGGGCCTCTCGGAGCTGCTCTCGTCGGTGCCCGTGATCCTGTTCTCACTGCTGCTCAACTTCTGGCGACCACCGTACAAGAG
CAACGACGACATGGAACCGGAGGAGGCGTTCGTGGTCATCCATGTCGACACGACCGACGCGAACGAGAAGACGCCCCTGCTGGACTGGAAGGCGTGAGTG
CGGACGGAAGGCCTCCTTATCTACTACCAACCGCCGGACGAACTTTAGGTGATGTGCTCGAAATTGGTTTACTTTTTTTTTTATGAAATTGGTTTTCTTT
TTTATGAAATTGGTTCCCGCTAATCTACAGGATTTAGCCAGCTCCGGTATGTCGTCACGAGCTCATCTAGGAAGCTTTCTCACAGTGTTGAGGTGTCTTG
CTGCTATTGGTGCCTTACAGAGTCGCATACGCTAGAAACGTGGCTCGGACTGTCGCGGCATTAATCGACGGATTCACCCCCGAGCTACCCGTGATCGCAT
CAAAGCGTCGACAGAGCTCCTGAACATCCAGGTCGTGCTCAGCAACTCCATTCGCACCACTGCCTCGTACTGCTCGCACGCCTTTGACTGCTGTCCCACA
GGACGCGTTGCTGGGCGTGACGGCGGCCTTGAGCATCTCGCTCAGTCGGCAGTCGAGTGCAAAGGCATCTTTCCTGGCCTGGACGCTGCGTTTCACTGGC
TCGGGGAGCGACTTCGCGCGCGACTTCAAGGTCAGCGCCAAGTAGAAGCACGCTGAGGCGCCCACACTCGCCTGGACGAACTTTGGGCGCTCGCTGCCCA
GCAGCAGCAGCGACTCGTTGAGCACAGCCGAGAGCTCCTGTTCCAGTTTGCCCGGGAAGTTCTTGGACAACGTGGTCGAGAGCTGCGGTGGGAGCTTCAC
AGGCAGCTTCTGGGTTGCGTATAGAGCTGGCTCGGCGAGGAACCTGCGGCGCATGTCCTCCGAGGCGAAGAAGTAAACTTTGTGCAAATACGAAGCGCGG
TAGAAGACCTGGCCTTTGACGATCGAGCTCCAGTCCTTGGCACCCTTACCGAGCTTGAAGGTCACGGGGCAGTAGCCTTTGAGCTCCGGGAACTCGCAGT
CGGCCACGGAGATGAGACTCAGAAGCGATGGGTCCAGCGGAACCTTCGCAGTGAGACTCTGAGCCTCGTCTTGCTGGTCCGTACCCAGAAACTCCATCGG
ACTCGAGGTGAATCGCTGGAGGTTCTGCGCATTTGCCAACCAAACGCACTTTTCTTGAAATTGGACGCAACACTGTCGGTCAGACACCCAAGAGCTACTG
TATCGCGAATAGCTCAATTCGACTGGACAGAACCGCTGAAACACTGGATAACTCTGGGAGTTTAACGTTCCTAAACGCTTCACGACTCCATCGAGGCGAG
CAGGTCGACCAGCGACAAGCTCTTTCCGGTACGCACGCATCCTGAGAATGTGGGCATCGAGTCGTTCATGGGCCTGGGCGAGTGCATTCCAGAGCGACGT
TTGTGTGGCGTCGATCTGCCGTACGTGGAAGCTGCCGTACTGCGTGGTCCAGAACGCCAGCAGATCGATTCGCTGTCGCTGCCAGACTGAAAATTGCTGG
ATGAGCAGGTCTCTTGCAGCATTGAACTCCATGCGCTGGATCTGCTGGTACTCTTGAGCTGTTCGTTCCTGTGTATCCTCTGGAGAACCAGTAGATCTCA
AGATCAGTTTCTTGCGGCGATCCCAAATTACCTGGAAGTTGCCGTCGAAGATGAATAGCAGTCCTGGATCGATTGAAGTGTTGGTCTTGAACCGCTCGAG
GTCCTCTTGGGTCTGTAGGAAATCGTCGAGCACCCAGCCGTTGAGCTGGCACTGCGAGGACTGGAGGCGCATCATCATGGCTTCGTCCACTGTACTCGCG
TCTGGGTTCGCTCCCGCATTCTCCGAGGCCCGCAGGCGCTTGCTGAGAGATGTATCGCCATGACACTGCAATACCCAGTCGATCGCATGCTTGGGAGAGA
CGTACACGAGCTTGTATTTGACCGCAAGCTTGTGAGCAAACCTAGTTTTCCCCACGAACGGCGCGCCTGTGATAACGCATGTCGGGTGGTGAGCTGGAGC
CATCGAGACGGTTGAGTCGCGGATGTACTGGGACGGATTCGACAGGAACGCTGTCATGGTGTCCTTGTCGCGTGGGAAATAGAGGCGGCCCCGATACTGA
ACAGCAGGAGTGACGTTGTCTCCCAGGGCTTCTTCACCAGTCACAGGACATAAGGTGCCGTGCTTGCCCACGATCAGCTCGCCCGTTGCAAGAACACTGC
TGATAGCAGTTGGCTCGGATATGACTTCACTAGAGTCAAAGAGCGCGCTCTTGCGTCTCATTAGCGCGTCAAGCTCGGCTGCGATCTTGCTCACGCTCTG
ACGGAACGATCCCGACACGTCAACTGGCGCATTCGTTGTGATTGCAACGCCACGCGCTCGCAATGTATCAACAGCGACAGTAAAAAGCTCTTGGTCCGCC
AGGAGCTGCTCCTGCAGGCGCTGGGTCTCTTCAGCCTCGGCTTCTTCCAGGTTGAACTCGGGCTCTTCATCTTCATCTGGCGCTGGAGGTTCACCACCTT
CGTCTAATGGCACTGGACGACGTGCTTTCAGCTTCTTCCTGCACTCAGGCAGCCTTGCACGCCACTGCTTGAGCTGCGTCTGCACGATCTGCTCGTCCGA
CATGCTCACAGGAATGACGAGAGTGGGGAACACATCCAGTTGGAAGCAGAGTTGAAGTAGCTCTGCTGACGGTAGACGGGAATCCTCAGCACCGAGGCCT
CCCACGACGATACAACAATGCTGATTGGGATCAGCCTTGCTGCAAGTCTGGAGCTCGCTGCTGAGCTCCTCGACGTACAAAGCGAGTGGCGAGCGCTGAG
CGTCCTCGCTTTTCAGAGACTCACTTCGCATTCGCCTGGCGAGTCGCTCATTTGTCCCCACGAGGTCCAGGTCCGTAACAGAATACCCTTTGCTGGCGCT
GTTAAGCAGTGCTGTGACGCCCGTGGACAGCTCGGGGACCCCAGTGCCGCGTACTCCAAGCAGCACCACGACAGGAACGAGTGACGACGTCGCGTTGGAT
GCTTTCGGGAGATACTTGAGCGGATTCCGCTCAAAGGCGTCCTGTTCACTCTTGCCAGCAAAGCTATAGAAGCAGAACCTGAACGCCGAGACGAACTCGG
GTAGCCCAGGCACAAGAATCCGCTTCTCGAGCCAGGACACGGGACAAAACTGGTTCGTCTCGCCTCTGCGAGGTCCCGACGAGAAGACTTTCGGGGCCTC
GCCGCCAGCAGCAGCGTCGCCTTCAGTACCAGTTTGCTCTTCGCTGTCCAGTGGTGGAGGAGTGAAAGCTCTCGCCAGGTCTTCTGTGGTGACGTATCCG
TCGTCAACACGGTCGATGCGAGGTGCGAGCGGGTCGATCTGACGCTGAATCGCCGCCAGTGCGTCCTCGACAGTGTCGTATATGGCCGATGTCTTGAGGG
TGATGCCCAGCTCTCTCAACACTTCACTTGTTGTGATCAACGATGTCTGGAAGTGCTGGTGTCTGAGTGTCCTCACACCACCACCAGTTTCAGAGCTCTT
GGCTTCTCTATCGAGGAGCTCTTGGTCTGGATCAAGGACAATGACCATCTCGGGAAGACACTCGATCTCTTTCAACGCGGCAATCGTATCAGCTGTGAAT
GGCAGATTGCCAAGTACCCACGCTGCTGCTGCATCACTGGTGTTTGACTGCTGGTGCTGATGGCGAATCGCATCAGCGATGATCCCAACCGCGTGAGCTC
CAGAAAGTGTCTTACCCTCCATGAGCTCCATCTGCATAGCCATGGGTGTGCGTCTGGTGAGAATCTCGATCGCATCGAATGCTGGCAGCTCCAACGCAGT
TGCAACTGCACTTGTAAGACTCTGACGGCCTTCTCCAGACGACAATGTTGAGCTGCTCACGAGCCAAATGCGGCTCAGTGACTTGGCTCGTGGCGTCTTG
CGGAGATACTGCAGCGGACGAGCGCAGAGATTGTCCCGCGCCTCGGGTGTCGCGGTCAAGTAAACGCGTCCTGAGAAACAGACTGCGAGCGCTGAGTCTC
CGAGAACGAGCCCGTTGTCTGCTGTTGATGTCACAGGACAGAACTCCTTCCATCTCGAGAGCCTCCGCGTGCCTGTGGGCACGAGCGACCACGCTTCTCT
CTGTGACGGTGCGCTGCCATCCGCTTTGACCCATTCGCTCCAGTCGCCATGCAGCAGCCATCGGATCTGGTCTGCTCGACCGCTTGATAAGACTTGGTCT
GGTAGCGGAACGGGAACAACTCGCCGCGAGACATTGGCTCGCGAGATCCCCCGTGAGTTCTACAAGCAGAATTTGGGGACATAAACAGCAGCAACATTGT
CAGAAGACACAGCAAGATGCATAAGTACAAATACAGAGGCAAATCAAACGTACGCCAGTGATGGCGAGGACGCAGTGGTCGAGGATCACACAGAGCGACT
GCGACGCCAGGATGTGGATGACGTGGTACCGCAGCGTCGGCCCATTGACCAGCGCTGGGTCCAAGACTGCGAGTCGTTCTTCCACGCGAGTCACAAAGTC
TTTGTACCGGTCTCGAAAGCTCTCCATGAGCAGCGAGCGAATGGACAGCGTGGGCTCCTCGGGCTGCTCAATCCAGTTGCGCTCAGCCTGGGTTGGCTCA
GCAGGCGGTGGCGGCGGGCTCTCGAGTTCACTATCAGCTTCACCTGCATCGACAGCACCAGTCTCCGCATCAGCATCATCAGCATTCAGGTTGTCGACCA
AGTTGGCCGCCTCTCCTCCACCACCCGTTTCTGGCGCATTTTCTTCGTGAACTTTCACAAAGTCTGCATATCCGAGGGCCTCGATGCTCGCAGCGTCGCC
CGTGAGAATCGCGCGCTCACGGGCCGAGTACACACGGCGCGCCGTCGAGGCGATCCGGAACTGTTGCGTCTGCTGCTCGACGTCGTCTCGTGCTGCTGAG
AGCGCGACCAGGTAGTCCGTCCCGATCTCATGCTCGATCTCGTCGGGGTGCACATCGTCCATCACGACACCCACGCCCTCCAGAAGACACTTCTTCACGT
AGTACATGAAGATTTCGAGGCATTTCGTGCGTGCAAGCGTCTCACCTGCGAAGAGCGCATCGTAGTCGGTGTCCAGAAAGATCGCGTCCTCTTCGTGGAC
TGCCTCCAATTCATCTTGGACTTTGGCTGTTGCTTGGTCTGCCAGGGACTCACCAAGGGGGTCGTCAGGCAGGCTCTCTCCAGCCGAGGCTTCGTCCACG
GGCTCAGATGACTCGCCCACCGGTGCACTCTCCGAGTCTACTGCTGAAGCGTGAAGCTCTTCGCTTACTGTGGACGCTCTTGCAGCAGCTTGCTGCTGTT
TCCGCGCTCTCTTCCTGTGAATCGCGTCGTCCAGTGCCGTCTCAAGCGAAAAGTACTTCAACTTCAACTTGGTCGCAAGCAGCTTGGCGACGCGCGTCTT
GCCACAATGCGGCGGCCCGACGACAGCGACGCGGAGCGCTGGGGAGTGCTCGAGCGACTCGATCGCGGCGAGCTCGTCGTCCCAAGCGTCATCGCTTTCT
CTGTTGAGCAGCTGCGACGACGCTGGCGCCGAGGCGGCCGCGAGA