Description :
From Genome Similarity Track
Location :
Scaffold_330:556- 3080
Sequence
2524 bases(100 bases per row)
CACTGGAGACATCCAAAAGCATGTCGTTCTGAATTTTCTCTAACTCGATTCAAGCTCCGCGGAAACTTCATGTCTTCCATCATCAATTCGAAGGAGCTAT
TCCGCAAATACTTGCACATCATGGGCTGTGTCAGGATTGACGGCAGCCTGAACGCGCATGGCGATAGATAGGCGCGGATACTCCACAGCTCGGGGCGTTT
TAGAGAAGCAGAAATCACTTCAGCAAGTCCAGTGGGTGTAGTAACCGGAGGCTTCTGTTTGAAATTCCCTGACAGCAGTATCGTGGCATCACCAAAAGGC
ATGTCATTCTTCAGCAAGCCGAGAAGCGTTCTGTCCACAACCTCGTATTGGCATCGTTGGTCCATCGGCGCTTAGTCCCAATCGATAAGGCGTGTTCACC
TGAGCAACTCGGCCTCCGAGGGCCGCACACCAAATTTACAGGTGGACATCACGTCGGGGTCTAATGGAGCCAAAACGTGAAGTAAGTCGTACAGCTTCCA
GAGAGAATCTGGGCTGAAATTCCGCGCCCCCGAAGGCAATGCTTCCAGCGTGTCGTACACTTGCCAGAATCGCTTCAAGAAGGGACGACGATTCATTTGG
TGTAATGTGGACCAGCTGCCCCAGGCAACCTATGGACTTGCCATTTTCGTGCGCGAGGCGAGGACTACTTCCGCAACATTCTTGAAGCGTACAACTTGAA
GTGTCTTTAAGGACATCGCACGAGAGACATGATAGTGGACCCGTCTGCGGTGGAGAGAAAATCAGAGTCTTTCGCGCTGCCTATATCTACTTGATCTAGA
ACGGGCAAACTTGGCCTCATGCTGCAACTCATTTCCGCTACGCTTGACATTCGGTGATGTGGAAACGGAAGAAGACGTTGGAGATGAAAATTGCTATCGG
TTGTTTGCTCGAAAGCGTCGCATGAGCCTACTGGTCTGGATTGCAGCGCGGATACTCTCGATACTCTCAACGTCGATCCGAGAGTCGTGTTCGACAACGT
CATTAAGGCAGTTCTTCCTGAGGGTACCGATGCATCGGATTCTCGTATTTGGGGGGAAATGTTCTTTCGCGATGTCCCTGGGCGAACAGATGCCTCATTT
GGTCAGGCAATTGAAAAGAGGTAGCCTCGATTAGGCACCGATGGTTCTCCTCGCTCGACTCGATGTTCCCCATAGCCAAAGACGACCTTGAAAAATGGTT
GAATTGCTCCATCGACGGTTTTAAGATCTCCGAATGATAAGAGCCATGGCGATAGCACAGCAAAATCCGAATGTAGAACCGGTTCGCGTCTCGAGGCGAA
ACCGAGATCATACGCCCAATGTCTCAATCCCGCGCTCGCGGTACTTAACGATATCTATGTCCACATTCTCCTGACGAAACGAATGGGCACATAAGTTCCA
TGGCAGCAATGCCTTCAGGAGAGTCGATGCCGCATATCTCGCAGAATGCAGTAAGCATCGTGAATCTGTTAAACTCCAATGCATCCTGGATTCAGCGGTA
GTCGACCAGTGAATCAATAGTTGGCCCGCTTCGTGAACAGGCACTCGATGCACATGGTTTGACTTCCTCTGCATGTCGTACTTGAAAATCGTTGAATAGG
CTTCCGGCGGCGACAAATAGTGGGCTTCGAGATACTGCTTGATTTCATTAATAATGTGCTAGGGTCAGCGACcgctgccccccccccaccctCCCCCTCT
TTGCCACCTATCTTTAAGCCCAATCATGGCGCAATTGTGTCCCTTGTACACGTACTTGTACAAATACTACACGGACTCCGCAGTCGAGTGTATTTCCACA
TTTCCGTGACAGTTGTACCACTTCTGGGAAAAGTAGGGATTGTACGGGGCCACCCACCGGTtctcaacaacaacaacgccccccccccccccccccccct
ttcAGCCTATTTGGTCGGGGACGCCAAATTTGTTTGGACACGAACCGGACCGACAATGGTCGCTGAGGTCCTAGAGGTTGGTTGGCATCGATGGGCCCTG
GTTTACGTCATCAATTGAGTGGGTAGCCGTCCCCGTCAACTGGACCTCCTCCGCACTCCTTGAAAACTGGTTCGAGCAGTTGtcaacgacgccgacgcag
aGACAGTTGATTCCTTTTCCACACAGCTCATGAATCACGCAAGTATAAATCGTTTCATACAGGTCGGGATGTGCCTCCCGATCAGGAATCTCTGCGCAAA
CGTATTTGTCGTAGTCAAGCGGAGTACTGTGTTTAGAGGCACTTCAAAAATGACCAACAAGTGTGCATGTGACAAACCGAGTCTCTGGAACTCTATCACG
TAAACGAATGCCAAAGTCTTGCCAAAAGCACGTTTCTTAATGAAGTCGTCCAGAAGCTTTATTTTTAACACACGCACCACGATGTCGGGGCGATCAGACG
TAATTTGACCCAAGAGCAAACTTACCTGAAATTTGCTTCATCGTAGTCACGGTGATGAGCAAGTCCGGCTTACCATACTGCCGAACAATCGCCATAGAAT
CGTAGTACTGTTGACGCATATACC