Description :
From Genome Similarity Track
Location :
Scaffold_1242:556- 2675
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1242-snap-gene-0.1Secreted protein

Sequence
2119 bases(100 bases per row)
CACAGTACACCAGCATCCAACGCCATCCCCGACATTCTGGACGGAGTTGTTCCAGCCCATGCGGTGCCCGACGGCAATTCAATACGTCGGTGGATTGAGC
TTCGCACAGGCGTGGAGCAGTCGTTTCGCCTTCAACACGCAGTCGATTACGCCTTCGTCGTCGACGGCAATCAACCTTGCCCAAGCTCTCCGCTCCACCC
TGGGCATGTCGTTTTGCGATGACCCTACGATGCCTCTTGCTCCATCCCCGATCGCCCTTCCGGCAGCGCAAGCTGTCGCCTCGCCGCCCCCTCCGCATCC
GCCCCACTATCTCGAGAGGCCTGGCGCCGCAAACCGCGACGATAGCATCGCATCCCTCTTCGCCACGGATATCTCTGTCCGTTCCATTCATTCCTCTCCC
CGGATCACTCCCCGGATCACTCCCCCTGGTCTCCCTCGTGATGAACGACCAACCCTCGCAGTGGCGCCAGTGCCGGAATCATCATCGCCGCACGAGCCAT
CCGGCTCGCCGCACGGCAACAGGGTGAACGTCGGCGAGCCCCCCGCACCGCTTCCGGTCATACCAGTGCCGGTGGCAGAGCTCGACACACGGATACTGAT
GGCGCTCGCCCAGCAGCCCGACCTCTTCGCCCATTACGTTCAGCTCGTCACATCTGCGCGCCCGGTCGTCTCCCCTCAGTCTGGAGTGGAGCCAGATGCA
ACTCGCCGGCCGTCCAAATATTCGTTCGCGCAATCAGCGGTTCAAACTCTGATCCATCAGAGTATCACAGCCCCGCAACACCGAGGTACACCCCCTTCTG
TGTTTGCTGAGACTGTACTCCATGCGGTTGCCGTGCGGTTCCAGCCTCATCCGGGGATCATCACTCGACTGTACGACTTCCAGTTCGGCATGCTTGGGCT
CTCCATTCTGCACTTCGCACCGTTTGGTATCCATCAGCGGATGGAGTGGCTCAACAACGGCGGTGTCAACATGCAGAACTTTTCGGCTGGCGTCTCGATC
CCCAAGCCCCCAGTGGCCGCGTCGATGGGTGCCCTGATCGACGCTACCCAAATGCTCTGTCGATTTGGCAACGAGTACTTCGCCCAGCCAATGCGCGACA
TTCTCGACGGTCTTCTCGATTTTCTCCAGCAGCTGGACGGGTGGCATTCGTGGGCGGCAGCGGACCTGCCGCATCTAGTCTTCTGGATCAACTCGGTACT
CGAGCAGTTCCGCTCAAGAATTCAAGCGAGCAACGGTGGCATCCAAAGTTCCAGTCAACACACGCTGTCGCGACTGTCCCTCAACGATGGCGAGCTCCAG
AACGTCATGCATGCGTTGGCTCGGCGCTCAACTGCTCCTCCCGTCGCTCTCAACCCTGTGTCGCAAGCCCAACCTCGGGGTGCGATCAGTTCCGCACTTC
GCGAACGTCCGGTTCAACGTCCTCCGCGCATTCCGCCAGCTATTTTCGATCTCATCTCGAAGCACAATGGCCTCCCTATCTGCCTTCGCTACTTGTCCGC
GATGGGATGTCCATCGGGCATGTCAGAGAGGTGTGCATACGGCCCCCGAGTCCACGCAGCCCCGGCGACACTTGATGCTCGTGTAAAAGGCCATATCATT
CAACGCATGGGAGGCCTGAGCGAGCGCTTTGCGCATCTTTGAAGCCGCCCAAGCAGTTCTCGGTTCCACCTGCTCGGGCCGCGCGCCTCTACCGGAGCCG
CCACCTCGATTTGTCAAGTCCCCTCCGTCTCGTTTTCTCAAGTTCCAGTGCAGCTGCCGCTCGTCGGGATATCGCTGCGGGTTGCGACTACAATCTGCGA
GGCTCTGCGCTCGCGAGTGTTTCATGCTTGCCAACCGTACAAGGAGTCGTGGAGTCGACGAATCGGTCTGCATATCGCCCCCATCGCCTCGCCCAAAGCG
GACAGCACCCACGTCGAGCAGTACGCAACCACACAATTCGTCCTTCAGCATGGGATATCACTTGCGACTCTGGTACAACTCCGACGAGGAGAGGACGATC
GAGATCCTCGCCCCAATAAAGCTCTTGACCCGGATACGATTCGCCATCTGCTTCGAGATTATCCGCTCGTGGACACGCTGGTATCGGTCGCGTGCCACGG
CATTCGTCCGTCATGGCAT