Description :
From Genome Similarity Track
Location :
Scaffold_957:556- 1662
Transcript NameFunction/comments
Phypl_g11810hypothetical protein PHYSODRAFT_252207

Sequence
1106 bases(100 bases per row)
TGCGCGGTGGTCATTGCCGAGTCTGGTCATTCTCAAATTCGCTCCTTCCGTCGCAAGCCGCCCAAGACCACCTCTCCAACGACTTCCTCGCCATGCAGCT
CTTCACACCTCTCTTCGCGACGATTGCCCTTCTCTCTCTCGGCACCCTGGCcaaggtgcaggaggagacCAAGTCGGTTGACGACCTCTACGCGGAGGCT
GTCGCCGAAGGTGGCAAGCTTGTCCTGTATCACGGAGGTGATAGCATGATGCGCTGCAAGAAGCTTTTCAACAGCGCTTCCCGGAGATCAACTTCACGGT
GATCGTCGACTACAGCAAGTACCACGACGTGCGGATCGACAACCAGTTGGAGACCGATACGCTCGTGCCCGGCGTCGTTGCATTGCAAACGCTGCAGGAT
TTCACTCGCTGGGCGGACGAAGGCAAGCTGTTGACGTTCGTTGAGGGATAGCGAGGGCGCCTGGATGGCTTACACCATCTATTCGTTTTACACAAGCTAC
AACTCGAGTAGTCTCGACGGAGTCGCTGCACCCATCGCAATGGAAAATCTGACGGACTCGCAGTGGGCCGGCCAGATTGCCACGTCCTACcccaacgacg
acggcgctgtgCTTTACCTGTTCACACGCTATGTTGAGCAGTACGGCTGGGACTGGGTGGCAAACCTGGCCAACCAAAGTGTCGCCTTCCACCGCGGCTC
CAACGTTGCAGATGAAgtggtggctgctggcgagAAAGTGATCGGTATGGGCACCGACATTGGAGGCAACGCTCCGGTTGGCAACAACACCGAGTACATC
GCATGGGGCCAGCGTGCCGCCATtctggagaaggccaagcacCCTGCTGCGGCGAAACTGTTCATGAACTGGGCTCTGTCGGAGGAGGTGCAGTCGTCGA
CGGTGGCGCCGAGTGTGCGCACGGACATCAACACGGACAAGCCTTGGGATCTCCCCGAGGCCAACATGGCAGACTTCCCGCTGTTCATGGAGGAccgcga
gaaggtggaggagtgGACGCAGACGTTCACGCTCTACTTTGGTGCAGGGCGAGCCGACTCCGGGCGTCCTCGGCTTGCACCCCGGTCTGCAAAGGGTGTC
GCCTTC