Description :
From Genome Similarity Track
Location :
scaffold_22:55595- 57117
Transcript NameFunction/comments
Pl_112022conserved hypothetical protein

Sequence
1522 bases(100 bases per row)
CATTAACTGCTCCACGCGATTATCTCTGACCTAACTAACATTAAGCTGTGAAGTGAGCAGCAATTTTCCTCCTTGAATCGATCGAGGAACGAAAAGTAAC
AGCGATCCACCTCCTCTGCCAGGAATTCCTAGGAACCCAGCTCGCCATCGATCCAAGTACAGAGTTTTGCCTGCTAACGTTGTCATATCAGAGACCCAAG
TCACGTTGGTACCTGCCTTCACTTTGACTTGATCAACTTGATCACCCCCTGACATGATGTTTACATTCACATCTTCAGTGTCCTTGCTGTGAAATTTGAT
GGTGATTCTGCCGTCACCATTCTTGATCCAAGATCCAGCACTGTTGTTGAAAGCTTTTCCAACTGTAGTAAGACCCAAAGCGTCAGACGCGGGGCCATCG
TCCACTTCACCTATGAATTCTGTAGGACCGCAAATACTCTGAAAAAAATCCGAGGCAACGGTAGCGACGTTGGTGGGGTCCCAAACTGCCGCAAGCATCA
GAATTTTGTCGCTAATGATGTATGCATATTCTTCAGCAGTAAGATAAGAGCCATTAGAGCTCGTTCCAGAGCGAATGAGGTCGTCTACGATACCACCGAA
TGCCTTGCGTATATTATCCCGCGTGGCATATGCAGTTGCCTCATCGGATTCATTGATCAACTGCTTCATGCAATTGTTCGTGACGGTGGGGATTTCGTGG
TGCATGAGATTCGATTTACTCAAGATCACCCGGATATCATCTTCTGAGATGCTCGGATTCTCTTTGCGTAGATATGTCACTGTCACCCATACACGGTTTG
TTAGACGCTCCATGTCGTCTCCACAAGATGAATCCGATTCGAGGGCCGACTGCAGCGATGAAATGTCCGTCTCATCGAGGTTATCCAACCCATCATCCAG
TGTGATATTCTTCATGAATGCTGTGAACGCTGCCCAACTGGAAACAATAGCATCCTTGTTGGTCACAATCTCTTTCACAAACAGCTCGACAGTGTTGGTA
ACTCGGTCTGAGAATTTCATAGCTTTTGAAACCTTGATCCCGAGACAAGACATGATAGTGATTGGTAAGTCGAAAACGACGTTGTCTGTCTGGTACAACA
TTGTCATGAGTTGGTCCGTCGTAGTCTGCGGGTCGTTAACCTGAACAGTTCGTACATATTTCGTCGAAGCCTTCACTAAGTTTGCTATTTCTTTGCCACA
CTTAAACGCAGTTTGAAATCCTTTTGCCATCTTCGAGAACACACCGTATGCTCCAAACGTAGCTACTGAAAGTGCTGATTGAGCTAGAGCGGAGACTTTG
GCCAGCATTTCTAGCGTACAGTCGTCGTTCTGTCGAATGCACTGCATTCCACACTCGACGGGGTATTCTAGAGGACACTCTGCCCAACAAGTTCCGAGTT
TGTTCTCGAAACCAAGTGGACACACTTTAGCAACGTGAGTTTCGCGATAACAAGCCATGTCTACTCCAGCACCATGTGCTGAACCAACCCAATTTTTGTA
AGTCGATTCTAATGTGCTGATG