Description :
From Genome Similarity Track
Location :
Scaffold_86:55582- 58289
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_86-snap-gene-0.34Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_86-fgenesh-gene-0.21Conserved gene of unknown function
Pytap_DAOMBR444fgenesh-pag1_scaffold_86-abinit-gene-0.158Ribosome biogenesis protein BMS1

Sequence
2707 bases(100 bases per row)
CACCGATTGCGGTCAAGTGCATCGACCACTGCCTTGCCCTGAAGCTCATGCCCAGTGCTTTCGACGAGTTCTTTTCGGGAGTTCCAGCTCTGTATGCGGA
ATTTTGTTTGAAGTGTTTGCGGGATAAAGCGCGTCCGGAACACGTGATGCAGCACTACGAGGGCAACAAACTGTGGGCAGCCGACTGTGTTAATCGGAGA
CGTCAAAATGAACTCAGGCTCTTCGAAGCTATTGAAGATTTCATGTGGGAGGCCGATTTGTCGGAAGATAGCGTTCAGGAGTTGGCGTTGATGGTGTATC
TCAAGTACCTGGCGGATTCGGCGCCTACCCACGTCAAGATACCGACGAGTCTACTCGAGACGATCGAGAGTGAGCTCTCATCGCAACAAGTAGACCGCAA
TATCTTCGAGACGACACGTGAGGCGATCTTGAAAGACATGGAAGACGACCATTTCGAACGCTTCAAGGAGAGCTTGCTCTTCCAGGAGTTGCTTAACTCA
CTCTACTGCCCACAGATGATCTATGACGGACTCACTACGACGCACATCGCTCGACTGGACATGAACCCGAGGACAAAAGGGGACAGTGGACTGCAACTGG
AAGACCTCGAGGACGCTCACAGCAAGTACACGCAACACGACGACGCGAGCAGCTACAAGTCGACGCATAGCTACACAACAGGCAAGTCAATTGGAAAGAg
TGGGTCGCGGAGGAAGTACCTGATCGCGGCAGACGGAGGCGACATGCCGACACCCCTACAGAAAACTGGCTCGTACACGAGGAGGAGAACACGCACAGAt
ATCGGACTGGAGCGTAAGCTCTCATCTGCTTTCGTGTTCTAGAGTCGTGGCTGTGCCTGAGCTCAATGGAATTGCCTTGTGTGTGTGATGATGTCGTGGC
GTTTGGTCTGCGAGTGCAACTCGTAAGACACGaGGgACGAGAGGATGACGGCCAGGCTCGAAAATGATAGTGAAATAGATAATGTATTTCAGCTGGAACT
TCGAGTTGTACGGACGCTTTGGCACAAAGAGGTGCTTTTGGGATAGCCAAGCGAACGTCTCATATATGGTACACGACGCTGCTGGACGGTCTGGTGGGTC
ATCACACGGCGACAAAACGGTCATCCATGGTCTCATTCATGGGCACGTCATTGTCTTGGTCGTTGCTCTTGGCTTTCACGATGGGCTTCGTCTGTGGGGT
CGGCAGCACGGGCGTCGGCGCGTCGTTGGCGATGGTGATCTCAATATACGACGCACGTTTGTACCACATGCGCACGAGATTCCACTGGATCTGGCgTGTC
TTAAAGTTCTCTTGCTCATTAATGCGGCGGATCTGCAGCCGCACGCGCTCTTCCGCCTCACGCACTTGGGCTGTAGCGCAGTAAAACGACAGTCCCAACG
TGCACACGCAGCAACCGTACGCAAACGATGTGCAGGGCATGCATGGCCAGTGGTCCTGCAGCGCATCATTGATCTTGGTGATGGCCTTGTGGAACTCCTC
CTGCGTCATATACGACGCAATGGAGCTACCTGCATAGTTGGGGAAGTCCTCGTCGTAGGAAGATGCCAGTCCATTGACGAACATCTCGCCCGTGGGCATG
AGCACAGCGAGGCGGCGGTGCGTCTCCTCCGTCATATTCGTCTGCTCTTTCTCGTTGTCTCTGGAAGCCGCTCACTCCAGGTGTCTCTCTCGATCCGTCC
CAGATGGCAATCTGGGACAGTGGCTGGACCGTACCCCcTGTCTGGTTATTTAGTTAGCAACCAACATCCGTTCGTATCAGTTACAAaCCACGATAACCCC
GTGCCCATGCGCTTGGCCAGCCAACCAAAGGCACAAGgCgACGTCgAGTGAAAGGACGTGGCGGGCATCTTCGTCTTCAATTGCCTCTGGCCACGATGGA
CGGGCTGCTGGGGAAGCCGTCGAAGACGCACCGCAAGGCCAAGAGCGGTGCCAAGGTCAACAAGCAGAAGAAGAAGGAGTTCGAGAAGCAGAAGAAGGAC
CAGCCGTCGCTGGCCGAGCAGCGCAAGAaCCCCAAGGCCTTTGGCGTGTCCAAGGCCGGCAAGGCGCGCAAGCAGATCCAGCGCAACCTCGACCGCGCGC
ACCGCAAGGAGTATGTGCCGCAGGTGAACCGCGCTGAAGAGCTGCCGCCGCCCATTTCGGTCGTtGTCATGGGCCCACCGGGCAGTGGCAAGTCGACGCT
CATCCGCGTACGTGGAGACGGAGATGCATGCTGGTGAAAGAaGCGTGGCGTACTGACGATGTCTGTTTATTTGTGTGTGTGATTCCAGTCGCTTGTGAAG
CGCTACACGCGCCACAACATGGTCGAGATTAAGGGCCCTGTGACGGTGGTGAGCAGCAAGGACCGTCGTATCACGTTCTTCGAGTGCCCAAACGATCTCA
ACGCCATGATCGATCTGGCCAAGATTGCCGATCTTGTGCTGCTTATGATCGACGCGAGCTTCGGCTTTGAGATGGAGACGTTCGAGTTCCTCAACATCCT
GCAGGTCGTCGGCTTCCCTAAAGTCATGGGTATCCTCACGCACCTGGACAAATTCAAGAAGAACAAGTCGCTTCGTAAGACCAAGAAGCGCTTGAAGAAC
CGCTTCTGGACCGAGATTTACCAGGGCGCCAAGCTTTTCTATTTCTCGGGCGTCGGTGCGAACAAATACCCCAAGGGGGAGATCCAGAATCTGTCACTGT
ACATCCA