Description :
From Genome Similarity Track
Location :
Scaffold_1303:5558- 8502
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1303-snap-gene-0.6Transmembrane protein
Pytiw_DAOMBR242034maker-piw_contig_1303-fgenesh-gene-0.3Conserved gene of unknown function

Sequence
2944 bases(100 bases per row)
NNNNNNNNNNGTAGAGCGAGCAGTGCACGACGCCCTCGAGGAAGCTCTCGGTCGCGTCCACGACCGACACGCGCGAGAGGAGCTCAGCGGCGTGAAGTGA
CGACGTGCTCAGCGCCTGGGGGGCCATTTTTCTGGGCGTCGCGACTTCGCTCGGCTGGATCGACGACAGATTCGTGCTGAAGCTCCTTGTCGGGTTTATA
CGCGACGGCTGGATGGGCTTCTTGGGCAGCGGAAAGTGCTGGCTGCTCTGCTTGGCGAGGGTCTTCTTGTAGTGCGGACCGAGGACCCACTTGATCGACT
CGAAGGCCGTGCGCAGATAGATGAGCAGTAGCAGGACGTCCACGCCGATCATGACGGAATAGAGAGGCCCAAAGCAGCTGAAGTTGGTGCTCACGTGGGT
CGTGGCGACCAGCCTCCCGTCTACGGGTTGCCTCTCGACCGTGAAGTAGTTCTTGCTGTTCTGGCGGATGCCGAACTGCAGCCCGAGCATCTCGAACGTG
TCAGCCGAGAGCCACACGCGCGCGCTGAGCATGTCGCGCACCTTCGGGTTGGAGAGTCCGATGAACTCGCTCCGCAGGCTGTTAGGGCTCGCGCAGCCGT
AGATCATCGACTGGTACATGCCCGGGACCTCGTTGGGCCAGACGAAGCCCTCCAGACAGACCACCTTGTGCAGCGGATAGCTCCGGCTGACCATGTCGAG
GAAGGTCGTGAGCTCCTCTTCCTCGACGCTGCCCTCTCGCGCGAGGTCACTGATGCCCACGGTGATGTCTGGGAACAAGTACCGGTTGAGAAAGTCGGTC
GAGATGTGGTCCTGACAGATGGACGGCTGCTGCGACGGGAAGAGCAGCTTACAGCACGTCCACACAAGCGAGTCGAGGCGCACGGTGCTCGCGCCGACGA
TGTTCTGGCTCGTGAGCCTCGCAGTCCCGTAGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAGGGTGCAGTTCGAGCCGAGCACGGTGACTGTGAAGCCGCCGCCGCTGTCAAAGGACGTGAGGTTGTCGCACGAGGACAGGAAGTGCGGCC
AGGACGACGTCGCATTCTCAGACAAGCTAAAGTCGGCGCTCGTGGGCACCATGGGTGCGTTACGTAGAGTTCCGAAGGTTGCAGTCCGGAACGAGTGGGA
ATCAGCTGGCCCCACATACCTCAGCTTGTAGTCTAGGTCGAGCAGCAGGTGCACGACCAGGAGCAGTAGGATGACTGCGTTGAGCACCAGCGGCAGGTGC
AGCTTGATGGACTGGCGTGCTGGTGGTGACGACATCCCTCGGACGGCAGGCTGAGGAGCTCTTGGTGAGCGGCTCAGGAATTCGCTGGCGTGACGGTCAT
GCAACATGTGCGTGTGAAGAGGAGGTCGTTGGTTCTATTATAGGCATTTCGCAACAGTCTCAGGTCTCACGAAGGTTATTTAAACGCACCCGAGTCGCGC
GTGGTGCTCTATAGGAAGCCACCTAGCGAGATCGCAATGAGCCTGTCACGTGTGACGCGTTGCTGAGTTTCTCAGAGGTTCACACACCAAGCTGTTTGTT
GTCATTAACCCACTGAACGTCATCCTAAATACACACCTACAGACACCTACCTACACAGAGACATATACAAAGCCTGCAAGCTCTCGTTCGCTTGAGGCTC
GTAAGTGGCAGCCTAGTGCTCGAAGAGGCGCTGGCGCTTAGCTGGGTACAACGGCAAGGACGTGGGCGAGCGGCCGCGTCTTGGGTCGTCACTCACCACG
CGACGCAGAGCCAGAGGTCCAAATGACGACGGTGCGAGCGAGCCCAGGGACAGCGAGCGGCTGGCTGGGGGCTGGCTCTGGCTTTGCAGGAAGAGCGGCG
TGAGCGACTCGGCGTGCTGCATGGCCCAGGTGAACTCGGTGCGCAGCAGCGAGCAGATCGCGCAGCCAGCTGGGAAGTTCTGTGCGCGGCAGATGCGGAA
GTGACGCAGCAGGTTCTTTGCCTGCGAGCAGGACGCGTGGCACTCGCCGTCGCCCAGGAAGCACTCCTGGCAGTGATCGAGCACACCGCGCGCGATGCTG
CAGTTGACCACGTGGCAGGCGGCGTCGCCCTTGCAGCACTCGCGCGCGTGAAGCAGCAGCGCGAGTCTCGCGGCCAGATCCTTGGTCTGGAGCACACTCT
GCGTCTGCTGGGTGAAGCGGCTCTGGATCGACGGCAGGCGAGGCACTGGGCTGCTGGTGCTGGAGGATGGCGACGTGGAGGCTGAGTTGTCAGTCCCGTC
TCCGAAGCGACTAATGGGGCTCACCAGCGGAGCTGACGAGAAGCTGAGCTGACGGAAGCCTTCGATCGGCGCCATGGGCAGCACGAAGCCCCGCATTGGG
AGCGTCTCGGCCTGCTTGAGAATGTGTGCACTCAGGTTCGGACGGCGGATGTTCATGGTCGAGTGTACATGCGGCAGGTTGTGGTTCATCAGCGACTGAC
TATCGAGAGCTGCTGGACTCGAGGAGCTCATCGTCGTATGGGCGATAGCCATCGTTGTATGGAGTTGTGGTTGAGGCTTAAGTGGTTGCTGGCGAATTCA
GGAATGAGGCTTTCAGTTTCCATTGAAAGCCTAGCCTGACGTGCCTGGATCTTGCCGTATAGGGAGGGGACGTCTCTCACTTCTCTCACTCTCTAGCTCT
GCCTGCCTCTGCCAGAACTCCAGTGTCTCTCTGGCCCCAGATGGCTGCGAGGTCCCTCATGGCGATTGGTCTGGATGGACGACGCTGACGAGCTCTGGGC
TCTTGCTGTCCCACCCGCAGGCTCTTCTGTGAATCTGAGGCTGA