Description :
From Genome Similarity Track
Location :
Scaffold_1012:5558- 8412
Transcript NameFunction/comments
Phypl_g12053hypothetical protein

Sequence
2854 bases(100 bases per row)
TAGTGCTAGTAACACTACTAGTTTCGAGAAGCTTCAACCCACGTGAGATCTTTAAAGGGCACGCGAATGTGTGGTTTCCCTGCCTCCCCCACCTCACGCC
CGCTCACTTTTGGATTCCCCAGTCCACAGCCACGACCGATGGAGTGTGCAAAAATTGACTGTTGTTGGGAGGACGTGCCAGAGACTTCTCCGTGCAACGT
GTGCGGGCGTCTGGTTCAGcacttgtgcagcaacgagctgtgtACCAAGGCATACCTCTCCAAAAGGTGACACCTCAACGCATTGCTTCTTTCGGATCCT
TGATCGCTCTGCTGATAGAAGTGAAATGCAGGTTTTGCAGTCATGCGTCCGTTGGCAAGCTCTTTAATACCGATAGCGACTCCCAGGAGCTCACACCGAG
TAGCCTCTCGGGTATACCGATGTCGAGCCAGGCCACGGAGATTGACCTCGCCCAAGACGATGCGGAAGGGGAACAAGAACCCATTAACAGCGTTCCGGAC
CACATCACCCATGCCCTTCCTCCGAACTCGATTGACGTTATTTTAAAGTTGATACACCGTCTCGGGAAACCATATACGTACAAGAGCAAAGCATTTACGC
ACATTTGTTTGCTGTGactgaagacgaagacatgGAAGCAGTCACTGTGTCACGCCAGCAACGCAACAAACACCAAGACGCACTTGGTGTCAAGTCACAA
GGACCACGAAATGGCTgtcaaggagcagcagtttCGGTTGAAACGCGCCGATCGCTTCATAGTGAATGTGACAGTCAAAAAGGATACGAAGCGTGCAGTC
TCAAGTGAGCCAAttcggcaagaagagcagcatgtccagcgccagaagaCCTGGTGGAAAGCTCCAATGAGCCAAGACCAGATCTCGGGCCACATCGCTC
GCTGGCTGATTCGAGATGGTGAGGCTTACATTAAAAAAAAGGTGTTCTGACCAAAATGTGTTATGTGCAACCAGGTTTGCCTCACAACATGGTGACCACA
CCAGCCTTTTacgacttcctcgtcggcgtGACGGGAGACCCAAATGTTACCATAGCATCGAGCAAGACATACAACGACATCTTAGACAACCACTACAACA
ACTACGAGAAGGATGCCTCCGCACTGTTTGCTAAAGAGTTTGAGGAGCTGCATGAGACCCCGTTCATGATATTGGAGTACGACTTGTGGACTAACAGTTC
GAAGAACAGCATTGTTGGTgcatcctgcagcttgagcaacCATCTATGGCAGCCGCGTCTTCTAGCCCTTCTTGCGAAAGTAAAGAACGACGGTCATGAC
TTCGAAGATGTAGCCGCGTTGCTAGATGAGCAATTGAGGGTTCGATATTGATTGGATGTGAGCAAAATGGCTCGCTTTACTATCTCAGACAACCGCAGCA
ACTCGGACGGTTTCAAGGCAATTTGACACCACACTGCAAACGGATTGCACGATGCACGCGCTCAATCTGTGTATTGGTTACATTACCGGGCTGAAGGAAA
ACGTGAGGAATGAGTACAGGAAGGATGCAAAGACCAAACTGTTCGTCAAGACGAGAATTGTAGTGAGAAACGGTGGATCATTCCCGGAAGGCGGGGCAGT
GATTAGtaagctgcgcgcgctcaaCAATTTCTTCTCTTCGAGCAAATCACCCGAGCGAGTAGCCCGACTTGCAGAGGTTCAACGATTTCACAAGCTACCT
CAGCTAGCAGCTCTGGTTGATATCGACGTTCAGATGGCTTCTACTATCAAGTTGTTTCGACGTTCAATTATCAACTATCCGGCATTTCAGGCGTTCTTCC
AGAACGCAAATGTAGGGAAGCGGGAAAAGGATATTTTCAACTCTATCACACCTGCGGAGTGGGAACTGATGGTTCAAATGGAGGCAGTGATGCAACGGGT
AGCAGAGTCAGCCCTGGTCGAGTCTCAATCGGCAACCATGCTTTCTTCCACGATGTAAGTGGTCCTGCGCGTAGCTTCCGCCCGAATAAATTCGTACAAG
TTTTCGTCCTACTGCTTGAAAGGCACTCGCGACACTGAAACCAATGAGAGAACCTTCCCGCGTGTTCAACTAACTCTGTCAGATTTGTCTGAGCTAGCTC
AGCGCTGCATCAAGCGTACACTACATCAGATAGCTGAGCGGCTACCAAAACCATCTGTACCAATGGGCATGGCATTGCTTCTATACCCGAGGACAAAGGC
TGCTGCCAAGCATTGTCTGCGCATTCCCGACAGTGCAGAAGCAGCCACCAACAATATTCTGGAGGAGACGAAGGCACTTCTGCGCATTGAACACCGGGTG
TAATATAAAGCGCTGCGTGCAAACGAGGGGCAGGGGGAGGGGCTTTggcttccgcttcgagcaCACCACAAGGggacagcaacagcagtTTTGACTTTGA
GTTGGTCTTGTTGTCTGGGAAAGAGGTATCTCAACCCGCATTGCCGATGCTACACTGAACGCCAAAGCGGATGCGCTGTTGGAAGAGTGGCTAGGCCTTC
GAGTCGAGTAGGCGGACGTGGTGAAATCGCAGTATCCAAGGAAGGAAGAGTGTGAAGGGGTCTTGGTCAAGTTGAGCATGTGTGACAAGAAGCGGAATGT
CCGTGTGTGGAATGTGGAGCAGCTCTGCCAGCAATTCGATGTGTGTCGCTGGTTTTCTAAAAGTAGCCAAGCAAAATTCCCTTCAATCGCGAAACTTGCG
CGCGTCTGGCTGGGTCGCGGATGTTCAACGGGTTCTCGACTGGTTCGTTTGTCACGAGTCCCCTGCGAACAAGCACTGACAACGAACGGGCGCAACGGCA
GCTGATACTGCGCCACAACcgtctcgagctcaagcgcatgGAGGAAAGCAAGCG