Description :
From Genome Similarity Track
Location :
Scaffold_303:55577- 60792
Sequence
5215 bases(100 bases per row)
CCGTGTGTTCCACGTGTACGCCTCTCTGATAACAAGCACAACATTGATTAGATGAATAGGAAACAGCACTCCTCTTGCATATACGTACGACACTCCTCCA
TCGCACGGCTCGATCCAGTCCCCAAGAATTGCACGGGTTTTCTATCCCACCACACTAAAGCCGTCATTAGGGGGCAAGCTTTTGCCACTGCCATTCTTGT
TGTACCGTGCGGTATGCTTTTGGGTCGGTCTCGATTTTTTTCAACAATTTGCTGAGGATAGCCCACTTTGTCACCCATTATCGTGCCGATACTGTAGACA
TTCCTATGTAGTAGTTGAAACGCCAGTTGAACTGACGTATAAAATCGATCCGTCACTACAATGTGATAGACGTCATCTTCGGGTGGTGGCAGGACAGCTT
CCAAGTTTCGGATAACTGCTGACGGCCCGGTGTTTGGATCTGCAGATCGCTGACTGTCTGGAACGTTGCCTACTTCATGGACCTGCTGCGCTTTGCCACA
ATACACCTCAAGTCTTCTTGTTGTAGGATACAGCATACAAGCATACAACATTAGATACAACATGATAGACTTGGTCAAAAAAAAAAACCGCGAGTCCGCA
AGGACTCGCAGTCATCTCACCTATACAGTAGGAAGTATCTGCACAACACGTCAGAAAAAGCTTTGTGCCCCACTTGTGAGGCTTCGCCTTGAGATATTGA
CGCGTAGGATTGTTCCGGTTCTTCAGAGGTAGAACGCCCTCATCAAATGATATGATCGGCGGCGTTTTGTAACCCAACGGAAACGTTTCTTGCAGCGTTT
CAACGATAGACCTGACTTTCCAGGCGCGGTCAGTTGCTGCTCTCGTGTCTGCGTTGTTGGTGAAGTGAAGATTTCCCATGATGTGTTCAAAGCGGTTTCG
CGGCAAAAAATCGTTGAACGTCCCCCGTGGGATAGCTCCCACTGCATTAGTGCCCCAATGATCACGTAACCTGCGGCGGTGAGGGTTCAGCATTCTTGCC
ATCAGTAATCCAAGCGCTTGCAGTATCTCGTGCGGCTTGACGTCCCGCTTCTTGGCCTCGCGATGCAAAAACCACTCTTTGGACTTCTTGGCAGGTGTCT
TCTGCGAGCTGAACATACGCTCCACTCGTGAAGTGAGGTTCTGCACAAAGTAGCGATTGGTTTCCTTTGCAACTTGTCTCCACAAACTCTTCGGCATGAA
AAAGAAGAATAGCTTGAGCGGTGAGTGTGTCAGGGCCAGTACCTCGTCGGTTGGTCCATACTCCCCAGAATATAATCCTGGGTAATGTTGGTCAGGCGGG
AAATTGTCTGGGTCTACATGTTGTATATACATCATATATCATGTTAGAATATGTTGGAGGCTACACCCCTCATTGTCACGAACCTAAGCTCCACCCGTTA
GCTCGCATGGCAGCCATGTTGGCATCGTCCATCACAAAATCAACCATTTCCGGCTTCTCTAAGACGCTCCACTGCTGTGTCGAACCAGCTGCTTCTCCAT
CAGCACTCATAGTATCTGATCCAGCCTCACTATCGTCCTCATCACTGTAGTCTTCACCCGACGCAAAGCCCTCACCTTCACTTCTCGCTCGACTCCACTC
GTCATCATCATCGTAAAACGTAATCTCGGTCTCTGTTTCCTCGCAATCAGAGTTCAACGCATCAAACTCGTCAGCGAAAGCGGGGGCAGCGATAGGAGAG
GCTAAGACCGACGTTCTTTCAGGTGAAATTGGAGCGGAACACAGCGAGGCTGGAGCAGAAGTCGGCGAAACAGGGATAGAGGTTGCCGCGTCGGGGACAG
GAGTCTGGGAAATGGATGCTGAGCTTTCACTATGATACGCACAACGTTAGTATACATAATCAGCATCAAAGACTTTGCCACGTACCAATCGTCTTCTGGT
GCTGCAACTGGACATTCAGGAGCTGGACATTCAGGAGCTGGACATTCAGGAGGCGGGGGTGGCGCAGGCGCTGCAGACAACGTTCGAGGCGACGGTGCTT
CTGACGTATCTTGAGGATCGGTGGAACCCCTGTCGATAGACAATATATGTTAGCTGCTGTTCATGTTGTTTACATGTTGTCGATAACGACGTTGTAGGGA
AAGCATAGCGACGCTGTATCCATGTTGTATGTCCCAAATGTTGTATGTACCTGCGCAGCGTACAACAACACTTCGTGAGAGCATGTAGTATCTGACAGCA
TAAAACATGGTGTACCTCTCTGGTGTCCCACTTGGTTGGCGGCTCCTCTTCTTGTTCGCTTCACCAATCGCCTCCAATCTCTTCCTGGCCTCGGCCAAAG
CGATGCTCCCTTGTTCCTCGGCATTCGCCGAATCTTCACAGCGCGATTCGGCAGCTGCTGTCCTCGCTGCTTTTGCCGCTGCCTTAGCAACTTGCGACGC
GGTGGGTTTTCGTGGCTTCTTGGTCGGGGTCGCCTTCTTGGTCGGGGTCGCCTTCTTGGTCGGGGTCGCCGCGGCCGTCTTCTTCTTCTTCTTCTTTGGC
GGCCGTGTCTTGACTGGGGAGTCTGCTGCATCCAGTCGCTCATCGTCTGCATCAGCATCCGCTTCCTCGTCGAACCGATCGGGATCATAGTCCTCATCAT
CGTCGCTCAAGTCCCTACTAGCAGCCAACCGTTTCTTGCCGGAGCCTGCCAACGTCTTTGCGGCGACAGCACGTTGCTGTTGCGAGATCAAACGTCGCTG
CGCACGCACGTAACAGGCATCTTTGCCGATCGGAACCGGAAGCAGAGGACGAGCTGTCGCGCTGCGTGTAGGTGCTGGATCTTCTCCGAAGTCAGCATCC
TCCTCTCGTTCGCCAGCCAGGTACGCCGCATGCTCCTTCCTGATGCGCTCTCGGTCGTGCGCAGTTCGGCCATCCAGACGTTGCCGGAACTGCTGGCGTT
CGCGGTGTGTTTCTCGAGGCGGGGCCATCGTGCACACGTGTCTCTCCTTCAGGTCTTTTCTCGAAATGAGCTCTCAGCCACCAACCCAGGGGAGAATCTG
TATTGTTTATTGCCAAAGAGACTGATCTCAACAACCCCAGCCCTGTGCATTCTCAAGTTTGCCCATATTTTGCAACAAAATAGCCCAACTTTTAACATGT
TGTACGTACAACATGATTCCTGCTGTACGTACAACCGTTGGGCGTTGGGGGGTTAAATCGGCGATAACTTCGGCCGTACAGCTCCAACGGAAGCGTGGTT
GAGCTAGTTTGAAAGCTCTACTTACGAAGCGTCAGCACGTTTTATATTAGCAAATTTCTTGCCAATTTTTTCAATTCCTGACCATTTGAACTATCACTTT
ATGGAGGGGTGGAGTTTTTTGTCGCTTTGACGTCAAAAATAATCAGAACTAAGCTTTAGAAATATACTAGAGAAAGCGCAAACGAAGCTTAATCTAGTGA
TATATCACTAAAAGCAATTGAACCCATTTTCGTGTCAATTACTCTCAATCCGTGTGCATACAAATCCTCATATGAACACATTTTAATTAATCGTCTCCTT
CTCAGTATGGACATTGACCAATCACACATGCGAGGTTTTTAAAAGAAAAACCTAACTGTTATTTCTTTTTCGGACCGGAGAAGTATGTAATACATTTCAC
ATCCCGCCGTTACTAAGCTACCAAATCCGCCATGCCCCGCAATCCTACGAGGCGGCTACGCCTTACCTGGTCCGAGAAGGTGGTCCCTCTCTCGTACTAT
GTCCTACAAGGCAATCGCTGAATGGGCCGTAAACGAGTTCTGTCTCCCAACCACTCCCGGCAAAGCCACCATGTGTTGTATTTTCAAGTCGTCAGCTACA
CTACTGAAGCAACCAGTGGAGAAGGCTACTCTATTATCAAAAAAGTGATGCATGCATTAAATCGCTTAGGAGAAGGACACGCCGAGCCTTATTCAGTAAA
TTTACCTACTGCATTGATGTGGTGAGAGGGTGCGTGGTCGAAGGTGGCGACACCATTCCAACATTCGGGTTTAGCTAACAAAGCGAACATCAATTATTTG
CTTTGTTAACTTATATCAATATAGGCTGTTTTTCGCATGGAGCTATGTATTACATGTATTAATACAGACCGGCATAAATATCAGGCGTTCACTATTCATG
CAGAATACTGTATAGCACTTATGATGTAATTGCTTACTGTTTCTTGTATCGAGACAGTCCGACATCGTGTCCCAGTAGGATTCAGGGGGTAGGGCCTATC
ATCGGCAGCAGCAATTGATGCGCTTTTGTTGTCCCGCTGGCACAATCATTTTTTCACAGCCTTTTTTAGTTTTTTTTAAGCTAAAAAACACTTTGATATT
TTATTTTGTCATAAAAATTCCAGCGGTATTTTGCGCGTCTTTGATCTCATGGATCGACTAAGAATCACGGGCTAGGCGTGCCATTCAATAAACGAGAGCA
TGGATGTCATATTTTGCACTATATGAAAACAAACGTTCTAATATCTAAAATTACTTTGTTTTTTACATTGTGTAACATCTCCTTTGTTTTCCGTACTCCG
ATATGGTGCATACAACCTGGCAAGCGTATCACATTAAGCGCGTGACGTTGACATCAGAACATGTAAACACTTGATTTAGGTTGACTTTGACGATCACAAT
TTTCGGTTCATCGCAGCCACTAAGGCCATTCTCGTTACCTGCTATAGTCGCGACCTGTAGAACATCAATACATACACAAGTTTAAACCTTATCCGTCCAC
AACCAGTAAATGACACTGTTCAGCGGCTTCACCCATCAACCTTTTGCTTTAGACAGCAGTAGCAAGTGTAGCACAGTCGACAACACGATGGACATGGTCA
AAAGACTCCATTCTCCTGCAGCAGCATCAGACGGTATAACATACGCTAGACTTGCATAACGCACGCAATTTTGGGTGACTCCAGAAAACACACTAGCTGC
TGTGTCACAAGGCCAATAATTCATAGAAGAGGAGAAGACATTCGAAAAACTCGCCTTTATTTTATCCCGGAAATGTGAGCAGCAAGTGACGTTTTTAGAC
TATTTTCCTTAGGTAATATACAGACCATTTGAAAGCTAGCTTAAATACGGTAGCTGTATGCAAAACCATAAATTTTGCATTTTGTTTTCGGTCCTCTGGA
ACGATATTGTGAACTGCGATCAAATTCGAGTATTTTACAACTGCAAAACAGCGGAGCAGGCCTGAAGAATGTAAAACCTCGTGTAACTAATCGATGCCTT
CGCAGTTCTTCAGCC