Description :
From Genome Similarity Track
Location :
Scaffold_114:55567- 58971
Sequence
3404 bases(100 bases per row)
TCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTAT
CTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTC
CCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGTCCTCACCCTTGGTAGGC
TCAAACCATCGACCATGTTGTCGTTTCTCCCAGTAACCACGTGCCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGGATCTGGCAAACTCGTCCA
CTTGGCGCAAACTAGAGACCCTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTT
GTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTTCCGACA
ACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCG
ACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCG
CACTGCGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTC
CTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAGTCGTCGGATCCTGACTCAGTTCCTGAGTC
AGGCGCCGTAACTTGGTGGACACGTCGAGCTGGGGCTGTGGGCGTCGGGGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGT
TTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAATGTCT
CGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTCAGTCGATGTAGGTATTC
CAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCT
GGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCCGCAAAGGTCAAACACTTCTCAGCATCCGAC
GCTTGATCTCTCATGAGGCCGACTTAACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGG
CTGAGATCCGTACTCTCTGGATCATGGACGATCCAACTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGAATGGGCCCTCCAGATCATCTGG
GTCGAATTCATCATGCGAGTTGTCTCCCTCAACGGACTCCATCTCCACGTCCCGTGCTCCATGTTCGTGAAGCATTTGCACTTGGGGCACGGGCGCTCTC
ATACCCTGTTCGTCCAGGAAACGACTCATCGCGGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGTTCCACTG
GCGAGACAGGATCCGTGAGGCGGTTACCTTGAGCCCGATCTGACGATAACCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAG
ATCACGCGTAGGGCGTACTGGGTCCTGAGCCTTCGCGTTCACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGT
CCTAAAGTCATGCGTCGTGGTTCGGACGACGTATCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGTGACGACA
CTGGATCCATAGTACGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGAATACTATGAGATCCAGGTCTAGCTCGAAGAT
ATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCT
CTCACCGGTTCCCTTGGATCTTCGATTTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAATCGCGTAGAGCTTGGTGGCGATACACAA
ACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGCCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGT
CTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCT
TGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGAT
CCACCTCTCTTCCGTCAACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGC
CTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAG
CGGGATCAGCAAAATCTGCGAGATTGCTGGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGA
ACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACG
TGGGGATGGGGGGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATTGTTCCGAATCCGAAGCTAATATTCGAGCTTATGGATCCAAGGCCTAGA
TCGTGGATCTGGCCGTAGGGTTTGTCTTGCGGGTGTGTTCCCTTGCCTTTGCGTTTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGA
GTTG