Description :
From Genome Similarity Track
Location :
contig_22:555611- 559606
Transcript NameFunction/comments
g5688.t1hypothetical protein

Sequence
3995 bases(100 bases per row)
CTTCGTCCGAGGGCTCGGTTCAGGTGCTGACAGCTTCAGTGACTCTTCGTTGTTGGTTCCTCGTAACAGCGTGGCCTGTTCCTCGGCTGCATGCATCAGT
TTCGCGTAATGATTCCACCCACCTTTTGGTTGGACAAATCCCCACAACGCGTTGTCTATCATTCGTTTGTAGATCATAGGCGCGTTTCTTGAGGCCGAAT
GGCATTCGAAGCCATTCAAAGTGCCCCAGTGCACAGACAAATGCTGAGATCTTTCGCGCTCGATGAGTCATCATTATCGCCCAGAATCCGCTGGCCGCAT
CGAGCGAGCAGAACCATAGGTAGCTCTCTAGACCCGTCAGCAGATCATCGACGAGTGGCATCGCGTATTCCAAGATCGTTGTGACGGCGTTCACCATCTT
GTAATCAATGCACAGCCGAATATCCACGCCGTTCTTTTTCAGCACTATCACAATTGGCGACGCCCACGGGCTATCCGAGAACGACACCAATCCAGCTTTG
AGCAGCCCTTTCAGAAGCTCATATAGCTTTGGCATGTGTCGAAGCGCCACTCGTCGGGCACGCTGTTTGATAGGAGTGTGCTCCTTGACATCAATATCGC
AAACCACTCCATAAGCTGGTGGAGGAAGCGCGTTACCACTCGAAATCATGATTTGCTCGTGTTTCTTGAGCACATTGATTAGTCGCTTCTGTTGCCCACC
CTTGAACTCGACGTTTTGTACATTTGGCGCCGAATAGTCCAGTATCGTGACCGAGGTCTCGGTCAGGTCCGGAAGGAAGGCAAGTTCTTGCGCATAGTCT
TCAAGTTCAATGTGGTTGGCTTGGTGTTCAGCCGAGTCCATTGCTTCATTGACGTTCATGGTTTCATGTCCTTCGGTGTTTAGAACCCTCATTACCGCCA
TGAATGTCTTCTCGAGCACCGTCGCCGGGTTCTTATCTATTTTGTTCCCCTTGGGCGGCGGTTCCTCTTTATTGACTTCGCCAACTGCGGATTCTCTGGT
GTTGAACGATGTCTTGGTGGTCACCCTGGTGGTACGCTAACCGTGATCTTGGCAGACGGTGCGATCGGTATAGATTCTGGATCATTGCCCACTGGCAAGC
CATCAGTTTCGTTGGCCGATATCTCGTCGTCGCGTTGTTGCAGGAGTCGTTCCCAGCGCTGGGCGCACGTGAGATGCTCGTCTTCATCACTGAAATAGTC
AGGTGGCCGGCTTCGCACTCCTCGGGGTGGTGTATAATCGCCTTTCTCCACTGCTGAAGGTTGTTTGGCGAGCCATTCTTGGTAGAACGTGGCTTCTTTC
TCGTACAGGGTTTGATCCCGTGATTCAGCATAAGCAATCACTTGCCATTCCTGGTACTTCCTTGAATCGAGGCGAACGTAGCCTGCTTCAACCGGCAAGT
CACCATGTGGTAACCATATCACAAAGGGCAAGTGAATCGGACAAAACACCAAGTTATCGGTGATATTCGTCAATCGAACTCGCTCCGGGTGACCACGTCG
AAACCTCGTCACAGTCGGCACCAAGCAGTCCGTTCGTCGGATCCATACAGCATGTGTATCCAGCGTTGGTTTCCGTTTTTGTAGCCGGAATTCTCCCCAT
TCGTGTCCAGGTATCTGTAAAAGCTCGGTAGGACCACCGAAGACATGCTTACGCCCGGGATTATCGTCATCCATCATGTTTTGCGTCTTGATCAATGGGA
TCCTGACCTCGTCCGTTGAGTGGCGTGAAATAGGTCGAGGCGAATTCCGGCTGGGATCATAAAATCGGTGCCAAGCACCACATCAACTCCAGCACTGTGA
TCCATAATCCACACCTCGAACTCGTACACGCGCTCCCAGCCGAGGGTCACCTTGACGAGTGCTCGGCGTGTGGTCGCTATCTTTCCTTTCTGTATTCCTT
GTATTTCCAGCCGTCGACCGTTGTCTGGATCGGTCCTCATCTTCAGCTTCTTTGCCATTGTAATGACACTCACATTTGCCCCAGTGTCGAGCAGTATCCG
CATTCGTGTGTCGTTTACCCTCCCATAACCAGACTCCTCACTCTTCGGTCGAACTTCTGCGACGACCACCACCCCAGTCGTTCTCCTGGTAGCAATCTCA
CCGTCTTGGCGAGTCCTCGAGGTAACTTCTCCTCAGCCACTGCACTCGAGACCCAGGCTTCGCACTCACTCGACCCGCTTTCTTCATCTTCACTCACATC
GCCTCCACCGAGGTTTAAAACTCTCTCCTTTTCATTGTCAGTCCATTTCACTCTATCTCCGTCGTCATTATTCGGCCATTCGCACTTGCCCACGTACGTA
GATATCTGCGTCGAGCGCGGGTTCGGCTAACTGTGGCAGCCCGTTAGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGCCCAAATACGA
GGGTCTGGAGCTCGGGCGAGAGGTTTCTTGTCAACCTTGTTCTTGACGAGGTTTGCGAGTTCTTGGTAAGCTTCGCACTTGCCTGCATCATGCACTTGTT
TGCATAGTTTGCAGCGCTTGTAACAATAGTGCGCAGAGTGAGTGAGACCACCGCAGGCAGCGCACGGGCCATACTGACGGCCGCTGTCGCGTCGGTCTCG
ACCACGAAAACGGTCACCGCGGTCTCCGCCGCGCTCAGGTCGGTCACCCCTTGGTGGGCGATTGTCAGTCCGGCCATAGGTGCCCTCAGCAGCAGTTCGT
CGTTCGCCTTCATTAGCCGCAGCGAGGTGTCGTTCATCATCTTCCGAAACGTAGCCATCGCTTCTTTCGTCATCGTAGTATTCCGACTCAGAAAAGTGTT
CGTCATCGCTGTACTCATCTCGACGTGAACCGGAATGGTCGGTGTAGTCTGCATTCGGATCCCGGAGTTGCATCTCAGCTATGAGTTCTGTCAACGTGGC
TTCGGCCAACATCATTCGTGGCAGATTGCGATAGTCGTCGCGTCGACGCTCGTTATCGCGGTCACGTCTGTCCCGGCGGTACCCATCCCGAGGATCGTCA
GTGCGCCGGTCGTCACGTCGTCGAGAGTTGTCGCGGCCTCGTGGCAGGTCGCGACCCCGATGTGTGGACTGTGATGTCTCCTTAGAGGAGCCACGATCTT
CCATCTTCAAGATCTCGTTGATCATCCGTTCCAAGTCATGGATGTCGCTCACCTGCAAGTGTCCAAGACGGTTTTGGAGGCTCTTGTCTCCACACGTCTT
TAAGAATCGTCGAACGTGGTCACGCGCTTCCCGTCCGCCGTTCGCAAATCGAACATCGGCGTTCCTTGCATAACCGTTGAGTCGGTTCAAGTAATCACAG
ATGTGTTCTTTGTCCTTCCGTTCCGCTGAATAGTACCGAGTCTTGGCCGACTCGTTAAACTGCGAGCAATAGTACTCGATGAACTCTGCATTGAGCAGCT
GCCAGTCGCGCCGAGTCCTCCTTGGGAGTTGACGGTACCAATGAAGGGCTCCGTCCCGGAGGCTCAGTTCAAAAGCCATGCACCACTCATTAGGCGGGTA
TGCGTCCCTTTCATCTCATAGACGAAGGCTCGTAGCCACTGCATTGAATTTTCTTGCTTGTCGCGGAGTCCGAGGTACGGCTTGATCTGGGCGAGGGGTC
GATGCGTTGCAATCTCGAGTTTCGGTGTACATTCAAACTTTCCATATGCTTGCTTCACGCATCTGACGCGCAAATTCAGCAGCTAAGTTGTCACCATCCC
CATTAAAATCCAGCAGGTCACGTCCGTCGTCCGATGAGTCATCGTTGCCGGACAGTTTCCACCCAGGACGTCGTCCGGATCCTCGTTTCGAGTTCCGCGT
TGGGTTTAAGTTATCGGTATCACGCGCTAGCCGCGCAGATCGATTAGTCGAACGAGGTGTCACCATGTGCGAGTCTTGAAAGTACGGGGAACGCTCGGCC
GTCGTAGCGAATGCTCCACCCAGCTGTTGTTCACTTGCACCGGTGCCTCCATGCCGCTTGGGTGTTTGCGGTAATGGTATCATCGATGGGTCGAC