Description :
From Genome Similarity Track
Location :
Scaffold_37:55557- 63159
Transcript NameFunction/comments
Phyke_g2204conserved hypothetical protein
Phyke_g2205conserved hypothetical protein
Phyke_g2206conserved hypothetical protein
Phyke_g2207cysteine protease family C01A, putative
Phyke_g2208hypothetical protein

Sequence
7602 bases(100 bases per row)
GACCCCCAACCTGCACAAGTGGCTCCGTCCAGTTCTTCACGTGTCTCCTAATTAGTCCCCTCACTGAGCAAGGGGTCGTACGTAGATTGCGGAcaaaaaa
gaagaaaaaaaactctACGAACTTGAGCGCAACGGGCGAGGAAAGGCGCGGCAAGCCCGCTAGAATCCAGTCTTGAGAGACACACAAAACAATCTCTGTC
GTGTACTAACGGACTAAGAACGGCTCACTTGCCGCCACTTGTCAATTAGCAGAGAGGGCGAACGTGCCTTGCTTGACCTATCTACCTGTCTAGCAGACTC
TTCGACGGTCGAATGACAGAGCTAGAGCTCACCTCGCTCATGACAAGCGCCACAGGATACTCGGAAGCCCAactcgtggtgctggtgctgagtATGGTGG
TAGTGGCAGTAGCGCTGCTCTCGTACTTCGTCGTGGCACCCGAGTATGAGAAGCATATGGACAAGAAATTCGCGGCCATGATCCACGCGACTACCGAACG
ACAACTTCAGGCTCAAAAGGCGGGAGAGTTGCTTCTCTCGAGGCTTAAACCGCGAAAGCACAAGTCGCTCGGTGCCTGGGACATCGAGTCCGGTTcgagc
gacgacgacatgtTCATTAGTCAAACTACTCAGCGACGCCACACTCACATGAGACCGCCACCAACGAGCGCCTTTTCGCCGCGCGAAATGGAGACTGAGG
AGGCACGGGTCGCCCGAAGGGAACGCAATGCTCGTCGTCGCAAGAGCGAGGGTGACGCTTTCCGACAGACTGACGTTGTGCAACGTGCCGACATGGTGCG
CCGACGAGTGCAGCTACGAGAGCTCGAGGAGGAAATCGCTGGTACTGTGAAGGAGAACGAAGAAGCacaggctgctgcaatcaACAACTCGAGTGAAACA
AAAGGGTCTGGAGTACGACGGTACTCGAACAACGCGTTGAATCTGTCGGACGACCGcgtcaaaatgctgcaagaACACCCTGCTGACTGCGCCGAGGAGC
TCACAGTACTCGCCCGGGCAcagtcgacagcagcgacgtgGCCTCTTTTAGACAGTGCAACTAAGGGCAAGATCGACAGTCCGCCGGATCTGCGCGAAGT
AAAACGAGCGCTGAACGTACTGCACGACGTGCTGAGCTTCTACTTGTCAGTGGATCACCGCGACATGAACAAGCTCACGGTGTTCTGCAACTCACTACTG
CAGCACGACGGACTCAACCGACTACGTGCCTTCGAGGCCTCGCGTGACCAGGACGTGCGGTCGCTGTCGAATTCGATCATCGAGAAAGCTGTGCCTGCAA
TCTGGCATTAAACGATAGAGGTCTCCCAGAGCGTCTCACTACTTTATCTATCAACCTCAGACCAACCAAGAACCCCAGGAAGGCCCCCCTGTGTTCATTA
TCCTCAATTCAGTAAATAACTCTGTCAATTGACCACACATTAACATGAATAACAAGGCAGCATTGACAGACTATCTCAGCTCTTACTTGTCGTCTTAACT
CCAGTTTTTCACATACTCCTGGTCTCATTCTGGAACGACGCAGCTAAGGAATCCAGTGAGCTAGACAGCACTGTACGTAGCACCAGTCGCGAGATCGAGC
CGCCACAGAGCAGCACGCTACCAGCAGTGGACGGTGTGAGCTTGGAGTTCCAAAGCACGAGCGTCTTGGGGGCTGAAGGCGGCGCCGTCGTGTCAGCTAC
GaactgcaccagcgccatgtggtcgctcagcagcaacggaccgctcttcttgatgctgTAGCTTACACTTGGGATCTTGTCGGAGCTGTCGGGGACTCCC
GCAGACTCGATCTGCTCCTCAACACCCAATGAGACGAGGCGTCGGTGACCTACGAGACCGCGACCTTCTCCAGGCTTTAAGGTGGATCCCCTGGCGAGCC
ATTCAAGTTGCAACCAGGCATCGAAGACGTCTTGGACCGATGCGTTGATGAGTTGCGAGAGTGCAAGTTCCTGTCCGTCATGCTCCGCGTACGCGTCGAA
AGCGTCTGCGTCGATGTAGTGCTCTGCCATCTTGGGGTGGATCAAAGGTGTTGGAAAAAGGGGGAATGTGATTGGAAGATATACGTCATGACCGTTTCGA
TCGCATTCCGTGATGATACACTGAAATGTGTAGGTCGCTGGCGTAGCGACACTGACGCCAGCATGATGTGGGATCGAATCTAATGTCGCCATCGCTTCAG
ATTGTTCAATGCTGCTTCGAGCACTTGAAGGTGCACTGCACGTCAAATGCAAGGATCCAAACTTCAGCCGAagcgttttttttttacatttCCCCCCCCT
AACTATTCGAGATGCTGATCAGctctggctgcagcacttgcgGCCAGAGCACCTAGATAGTTTTGCAGCACCGACCGCAGAATGAAGCGAGTAAAGCCAC
CACAACAGAGCAGGTGCCCCAAGATTGTCGGTACTGTCTTCACGAACCAGATCACGAGCGTCGACGGTGTACTCTCCTCGGACGCTGCGACGTCCACAAA
CTGCACCAATGCTAACTGATTTTGCATTGGGAACAGTCCAAAACTGCGGACCTCGTAGCAGATTGTGGGGATCTTGGATCGGTCTCGGGTACGACTCGGA
CGACCCCCGTCACTATCATCCTGCTCTGGATCAATGGGCAGTCCGACTGATAAAATCTCTTCTTCAACACCCAGTGCTGCACGACGCACATGACCGACGC
AGCCCCGACCCACCCCTGCGTGCAGCTCTGTGCCTCCAGCTCGCCAAACTTCTTCCAGCCACGCGTCAAAGACCTCGGAGGGAGATCCAATGACGCACTC
GGACACCACCAACTCTTGGCCTCTGTATCCCTGGTACTTCTCAAATGCGCCAGGGTCTACGTATCGTGCAGGGTCTAGGTGGCTTCGAAGCATTGCTCTT
CGGGCACTGCAGTCCACTGCAGCTATGCAATGGAGTAGTTCCCCCGCCTCGGATAATGCTCACAGCCGAGACCATCATCAGGAAAAATATCAGAGGTATT
TCAGCCAATTAAATTGCTCTATAATTTCAATTTAACCAATCGTAATGGTCTAACTGTGTCTGAAGTAACAACCATATTTCAGTAGTTGTCAAGAATAACA
TATGAGACAGCGAATCCGTCGCATCGAGAGTCACATTAATTACTTTTTTGCAGCTCGTTCCAATGCTTTCTTGGCTAGTGATCGGAGACAAGCATGGGAA
ATCAGACGAACCACCCCGCCGCAGTGCAACCAACTGCATACGCTCGACATATCCGTATTCATGGTCCAAAGCACGAGTGTCTTTTGGGGTGTCCTTCTGC
TGCGCCGGGAATTCAAATGACGTTTCGACGAAGCGCGCGAGCGCGAGATGAGATTTCAGTGAGAACAGACCGGATTTACGCATGTGGTAACAGATCCATG
GGAACCCAGGACACTTATTCTGATCTTCCTCGCCTTCTGCTGATACTGTTGGGCCTTCGGGCAAGCCCTGCAGATAATATCTCCTCCACACCCAGCAGAA
CACGACGTATATGGGCCGGCGAGTCCCTAACCAACACCTTCCTACATTTGCTCCCCACCAGTAACCCAAGCGTCTCGAAGCCACGCATCGAAAACTTCCG
AGGGAGAGCCTACCACGAGCTCAAACACTTCGAACTCGATAAATGGTCAAGAGGTTGAAATGTCAGAGTCAATGACCATTATGCCTTCCAACGCGCTTGC
ATCGACGTAGCAACCACTCATCAGGTCAGTTGATATCTTTTCGTGTCAAATCACCAATGAAAACGACTTACTCGAGGACTCTGTGCTAGTGTGATCACTG
ACAGAGTACTTTGAGATCAATATTATTGTATACGTGCAGGGACTTTGGATGCTCTACTAATTGTTATTTGATGCCCTCTTTGCAGCGTAATTGTGTCCGT
ACAGGTAGTATAATTTACAACGTCTCCTTGAAGGCATTGCGGTGACGGCTAGCGTAGATGACGCCACCAATCGTAACGATAACTGTTGCGACGCTCCCCA
CAATGCCCAAGGTAACCCAGCCATCAGGCGAGAACCCAACGAACTCGACttcgccaccaccatcaacTACCGAACGCGACGCCCCTGATATTGCCCCCGT
CGGTATCACGGGAAACACACTAACCCCACAATTAATCTTCTCGTCAATGGCGAGTCTCACGAAACCCTTCTCCCCCCAAGACGCCCCGTACGAGTTCTTG
ATAATCCAGTAATCCGTCGTGCCGTCCGAGCCATAGCCGACCAGCAACACTGCGTGGTCAATATCCGAGCTGGAGGCGAAGTTTCCGTCGTTCGGGCAAG
AATAAATGCCGCTTTTGTACTCTTCAAACGCGCCATTGGAGTTTAAAGCCACTGAGAtgggttgttgctgcagtgccagCTTAAGAAGCTCCGTCGAGCT
GGTACTGTTCTCACATGATGGTCCGACAACTTGTTTCCACCCCGATATGCTCGCGGATGCATGCTCGGTCGTCGAGTTATCGCAGACATCAGCCAAAACT
GTGGAGGACGACTGCgaggtttcttcttcgttgtaTGGCAAGTCCAGCTCGCTCAGTAGCGACCAATGCAGCTCTGAAGCATCGGCAAAAGCTGCATGCG
TCATGCCACCATTGCAAGCGTTGTTTCGCGAGCCCCAAATCATTGTGGTCTGCAGCCAACTCGAGCCGTTGGCACCACCCTCAGCCCAGCAGTAATTGAA
CGTAGAGATCATCTCACGAGAACTGCACTCCAGGAATTGCTGTGGCGACAGGGACTGCGGAACTGTCCCCGAGTTGACCACCACCGCCGTCTCGAttgca
tctgctgctgcaaaggcCCAACAGCTACCACACTGGTTCTGGCTCTTGACGGTAGTACAGATACTCCCATTCCTTGGGTTGTCCGTTGAGCACCAATCCA
ACGTCGCTGGGTACTCGAATGTCGAGTTGGCGAGTCGACGCGGTTCGTTCACTCTAGCAAGCTTGCGTTCTAGTTGACGTTGCGACGCACTGTGTTCTTG
CTGTACAAACTCCAAGGGAGACAAAGTCCGCTTGCCTTCACGGTACAAATGTCTCGAGTTGACGCCCATGGCGTATGGGAATTGCAAATCGTGGTTGGCT
GCATGCTTGTGCACCTGCTCCAAATATTCCACGTGGTTCTCCATGCGTTGTCGAAACTCATTTGGGCCTTCGTCCATCGCTTCATCCTGTAGAAATTGCG
TCACCATTTCGTGGGAATCCACGCCTGCACCATCACGATCCGCCCATAGACATCTTGCATCATCACAGCCGATCAAGGTGCCGAACGACGAAGGTTCATT
GGCCTGTACCGTGAACATCACAGCCGTCAGAGCTGCCAGAGCGAGCATTATCCTCATCACTATCTTTGCTCTTTGTGGGCAATTATTAGCTGATGCGAAC
CACGATGTGGTGTGGCCGGAGATAGCCGCTTGGTGTTGTCGACAACTGTGCAATTGTGACGCGGGTTTTTTCTATAGACTTCGGTCGCTTGATTGCGGCA
GGTCAGGTCTCACTCCATGGATGTGTGAATAAGCGCTGTCAGCATACAAACCTCAAGACACCTTGGTATTTCAGTCTCCCCCCCCGGCCGGCAGTTTCAG
CTTGGTGGCGAAAACGTCGAGCTGGTTTGAAAGGCATGGTGTCAACGGCATTGGTCTACCAAGGCCTGGGTTACCATCTTACTGTTGGTGACGAAATTAG
CAAGATGGACAAGGTCTTTCTTGAACTTGAGGTGTACAGTATCTCATGCATGCGACGTTGAGTTGGAGTCAAGGTACGATGCCCACAGCGATCGTGACCT
CTGTCTGGTCAACGAGAGACCTTGCAACTGCGTCAATCGCCATCTGGATTTTTGCCATCTTGACTTGTCGACATGACGCGGAGACCAGTCTTTGACAAGG
GTGGAAGAGGGTGCACTGGCTTCTGCTTTTATGGCCCTTTTTCTGTTAGAGAGGCACAAGAGCTTATGAGCAGTGCAATGCAGTTGAAAGCTTTATATTG
CTTCATACCATTATTCTGGTCCAGATATCAAACTAATCTGCGTTTGTTGGGGTGCGCACTGCGTACATGGCGGTGTTCTGTTTGCGGATCGTCTCGAATC
TCCGCTTGGAAATAAACATGCCAATGCCTGTGGTCACGACAGTGAAGATCGTCGCTACGGCGGCCACGGCGATCCACGCTCCAGGGCTGAGACCCACAAA
AACcttgtcaccaccaccatccacaccagaggaagctgctgcacctgctgaTGCGCCTGTGGGAATGACAGGGAAGACGTTCAAACCGCAATTGAtcttg
ccatcgccaactaACTTCATAAAGCCACCAGCACCCCACGAACTGCCGTACGAGTTCTTAAGGATCCAATAATCACCAACGGAGGAGTCCGTGCCGTAGC
cgacaagcagcaacgcgTGGTTGAGATCATTCTTGGAAGCCATGTCACCGTCGTTTGGACAAGTGTAAAATCCACCAGCGTAGTCCTGGAACTGGCCATT
TGAGGTGATAGCAACTGCAATTGGCTGCTTCTCCAATGCTGTCCGCAACAAGTCCGTGCAGTTGTTAGTAGTTGTGCAATCTCCTCCCACGACTTGTTCC
CATCCAGTGATGCTGGCAGCTGCATTTGTGGCACCAACAGAACAGAAGGAGGAGTCGTTCGTGCCCGATGAAATTGCTGAACCGGAGTCATCGTAAGGCA
TTGTGAGCTCGGTCACGAGACCCCATTTATTCTGCGCTGCATCCATGAAGGCACCGTGTGTCATGCCACCATTGCATCCATCGTTCTGTGACTCCCATTT
GATTTCAGACTGCATCCAGCTCGCCCCATCGACACCGCTGTCTGAAGCCCAGCAGTATTCAAACGTTTGCGTTGTCTGGAGACTGCTACAGGTGAGGAAT
TGTTGAGGCGATAGAGATACAGCTTGTGAAGTTTTCTCCGCGATTACGACAGCCGTCTCGAtggcgtctgcagcaacaaatgaCCAACAACTGCCGCAGC
TCTTTTGACTCTTCACCGTCGAGCACACACTGTAGCCGTAAGAATTGTCCTTATCGCACCAGTTCCAATATTCCGAGCTGCCAGCACTGGTAACATTGCC
actggtgctgttgctggcctCCATCGCGAGTCGACGAGAGTGTGCTAGCCGAACTTCTTGGTCTACAAGTTGTTCCACAGTAAGTTCACGTTTGGTTGAA
GACGTCAAGTGGCGTTCGGTCACGCCCATGTGATACGAAAATTCATGGCCAACTTCTTTCGCGTACATGTCCACATCTGCAttcacgaacagcaaacGTC
AGCAACAATCATAATTACTCGCCCTGATAATACAGATTTATTTACCTTCGATGTACGACATGTGCGCCTGGAGGTTGCGACGACTGCTCTCCATTTCGCT
GAGGGACACAACGTGgcgctggacgaggagctcccGCAGTGCGTGCGAGCTCACGACTTGGCCGTTCTCGCCTGCCCAGAGACATGGGTAGTCAGCTGAT
CGGACGGTTGGACAGTCTACGAGAGCACCGAGGGAGCGGTCTGTCGTCTTCGCGGGGGCGGCGCTGGTGCCAGTTGCCAGGAGCGCGATGGTACTGGTAG
CT