Description :
From Genome Similarity Track
Location :
contig_22:555563- 559558
Transcript NameFunction/comments
g5972.t1hypothetical protein

Sequence
3995 bases(100 bases per row)
AGGCTTCGTGGTCAGCGTCAAACTTCGTCCGAGGGCTCGGTTCAGGTGCTGACAGCTTCAGTGACTCTTCGTTGTTGGTTCCTCGTAACAGCGTGGCCTG
TTCCTCGGCTGCATGCATCAGTTTCGCGTAATGATTCCACCCACCTTTTGGTTGGACAAATCCCCACAACGCGTTGTCTATCATTCGTTGGTAGATCATA
GGCGCGTTTCTTGAGGCCGAATGGCATTCGAAGCCATTCAAAGTGCCCCAGTGCACAGACAAATGCTGAGATCTTTCGCGCTCGATGAGTCATCATTATC
GCCCAGAATCCGCTGGCCGCATCGAGCGAGCAGAACCATAGGTAGCTCTCTAGACCCGTCAGCAGATCATCGACGAGTGGCATCGCGTATTCCAAGATCG
TTGTGACGGCGTTCACCATCTTGTAATCAATGCACAGCCGAATATCCACGCCGTTCTTTTTCAGCACTATCACAATTGGCGACGCCCACGGGCTATCCGA
GAACGACACCAATCCAGCTTTGAGCAGCCCTTTCAGAAGCTCATATAGCTTTGGCATGTGTCGAAGCGCCACTCGTCGGGCACGCTGTTTGATAGGAGCG
TGCCCCTTGACATCAATATCGCAAACCACTCCATAAGCTGGTGGGGGAAGCGCGTTACCACTCGAAATCATGATTTGCTCGTGTTTCTTGAGCACATTGA
TTAGTCGCTTCTGTTGCCCACCCTTGAACTCGACGTTTTGTACATTTGGCGCTGAATAGTCCAGTCTCGTGACCGAGGTCTCGGTCAGGTCCGGAAGGAA
GGCAAGATCTAGCGCATAGTCTTCAAGTTCAATGTGGTTGGCTTGGTGTTCAGCCGATTCCTTTGCTTCATCGACGTTCATGGTTTCATGTCCTTCGGTG
TTTAGAACCCTCATTACCGCCATGAATGTCTTCTCGAGCACCGTCGCCGGGTTCTTATCTATTTTGTTCCCCTTGGGCGGCGGTTCCTCTTTATTGACTT
CGCCAACTGCGGATTCTCTGGTGTTGAACGATGTCTTGGTGGTCACCCCTGGTGGTACGTGTGATCTTGGCAGACGGAGCGATCGGTATAGATTCTGGAT
CATTGCCCACTGGCAAGCCATCAGTTTCGTTGGCCGATATCTCGTCGTCGCGTTGTTGCAGGAGTCGTTCCCAGCGCTGGGCGCACGTGAGATGCTCGCC
TTCATCACTGAAATAGTCAGGTGGCCGGCTTCGCACTCTTCGGGGTGGTGTATAATCGACTTTCTCCATTGCCGAAGGTTGTTTGGCGAGCCATTCTTGG
TACAACGTGGCTTCTTTCTCGTACAGAGTTTGATCCCGTGATTCAGCATAAGCAACCACTTGCCATTCCTGGTACTTCCTTGAATCGAGTCGAACGTAGC
CTGCTTCGACCGGCAAGTCACCATGTGGTACCCACATCACAAAGGGCAAGTGAATCGGACAAAACACCAAGTTATCGGTGATATTCGTCAATCGAACTCG
CTCCGGGTGACCACGTCGAAACCTCGTCACAGTCGGCACCAAGCAGTCCGTTCGTCGGATCCATACAGCATGTGTATCCAGCGTTGGTTTCCGTTTTTGT
AGCCGGAATTCTCCCCATTCGTGTCCAGGTATCTGTAAAAGCTCGGTAGGACCACCGAAGACATGCTTACGCCCGGGATTATCGTCATCCATCATGTTTT
GCGTCTTGATCAATGGGATCCTGACCTCGTCCGTTGAGTGGCGTGAAATAGGTCGAGGCGAATTCCGGCTGGGATCATAAAATCGGTGCCAAGCACCACA
TCAACTCCAGCACTGTGATCCATAATCCACACCTCGAACTCGTACACGCGCTCCCAGCCGAGGGTCACCTTGACGAGTGCTCGGCGTGTGGTCGCTATCT
TTCCTTTCTGTATTCCTTGTATTTCCAGCCGTCGACCGTTGTCTGGATCGGTCCTCATCTTCAGCTTCTTTGCCATCTTCGTTGTAATGACACTCACATT
TGCCCCAGTGTCGAGCAGTATCCGCATTCGTGTGTCGTTTACCGCTCCCATAACCAGAGCTCTCATCCTCACTCTTCGGTCGAACTTCTGCGACGACCAC
CACCCCAGTCGTTCTCCAGGCAGCAATCTCACCGTCTTGGCGAGTCCTCGAGGTAACTTTTCCTCAGCCACCGCACTCGAAACCCAGGCTTCGCATTTAC
TCGACCCGCTTTCTTCATCTTCACTCACATCGCCTCCACCGAGGTTTAAAACTCTCTCCTTCTCATTATCAGTCCATTTCACTCCATCTCCGTCGTCATT
ATTCGGCCATTCGCACCTGCCCACGTACGCGTAGATACAATCTACGTCGAGCGCGGGTTCGGCTAACTGTGGCAGCCCGTTAGGAACCAACCCAGTTTCA
GTTGGCGGGCTGCCTAGTTTAAATGCCCAAATACGAGGGTCTGGAGCTCGGGCGAGAGGTCCTTCTTGTCAACCTTGGTCTTGACGAGGTTTGCGAGTTC
TTGGAAAGCTTCGCACTTGCCTGCATCATGCACTTGTTTGCATAGTTTGCAGCGCTTGTAACAATAGTGCGCAGAGTGAGTGAGACCACCGCAGGCAGCG
CACGGGCCATACTGACGGCCGCTGTCGCGTCGGTCTCGACCACGAAAACGGTCACCGTGGTCTCCGCCGCGCTCAGGTCGGTCACCCCTTGGTGGGCGAT
TGTCAGTCCGGCCATAGGTGCCCTCAGCAGCAGTTCGTCGTTCGCCTTCATTAGCCGCAGCGAGGTGTCGTTCATCATCTTCCGAAACGTAGCCATCGCT
TCTTTCGTCATCGTAGTATTCCGACTCAGAAAAGTGTTCGTCATCGCTGTACTCATCTCGACGTGAACCGGAATGGTCGGTGTAGTCTGCATTCGGATCC
CGGAGTTGCATCTCAGCTATGAGTTCTGTCAACGTGGCTTCGGCCAACATCATTCGTGGCAGATTGCGATAGTCGTCGCGTCGACGCTCGTTATCGCGGT
CACGTCTGTCCCGGCGGTACCCATCCCGAGGATCGTCAGTGCGCCGGTCGTCACGTCGTCGAGAGTTGTCGCGGCCTCGTGGCAGGTCGCGACCCCGATG
TGTGGACTGTGATGTCTCCTTAGAGGAGCCACGATCTTCCATCTTCAAGATCTCGTTGATCATCCGTTCCAAGTCATGGATGTCGCTCACCTGCAAGTGT
CCAAGACGGTTTTGGAGGCTCTTGTCTCCACACGTCTTTAAGAATCGTCGAACGTGGTCACGCGCTTCCCGTCCGCCGTTCGCAAATCGAACATCGGCGT
TCCTTGCATAACCGTTGAGTCGGTTCAAGTAATCACAGATGTGTTCTTTGTCCTTCCGTTCCGCTGAATAGTACCGAGTCTTGGCCGACTCGTTAAACTG
CGAGCAATAGTACTCGATGAACTCTGCATTGAGCAGCTGCCAGTCACGCCGAGTCCTCCTTGGGAGTTGACGGTACCAATGAAGGGCTCCGTCCCGGAGG
CTCAGTTCAAAAGCCATGCACCACTCATTAGGCGGAGTATGCGTCCCTTTCATCTCATAGACGAAGGCTCGTAGCCACTGCATTGAATTTTCTTGCTTGT
CGCGGAGTCCGAGGTACGGCTTGATCTGAGCGAGGGGTCGATGCGTTGCAATCTCGAGTTTCGGTGTACATTCAAACTTTCCATATGCTTGCTTCACGCA
TCTGACGCGCAAATTCAGCAGCTAAGTTGTCACCATCCCCATTAAAATCCAGCAGGTCACGTCCGTCGTCCGATGAGTCATCGTTGCCGGACAGTCTCCA
CCCAGGACGTCGTCCAGATCCTCGTTTCGAGTTCCGCGCTGGGTTTAAGTTATCGGTATCACGCGCTAGCCGCGCAGATCGATTAGTCGAACGAGGTGTC
ACCATGTGCGAGTCTTGGAAGTACGGGGAACGCTCGGCCGACGTGGCGAATAATCCACCAAGCTGTTGTTCACTTGCACTGCTGCCTCCATGCCA