Description :
From Genome Similarity Track
Location :
Scaffold_1840:5555- 6947
Sequence
1392 bases(100 bases per row)
GCCGACCTAGACGTGCGCCAGCCACGCGTCAAAGGCGTCGTCTGGGGTCGCGTCCACTTGGATAGAGCCGCTCATCTACGCGCCGCTGTTGTGTATGTAC
TCCTCGTAGGCGCGTGAATCGCTGTATCGGCCGCTTGGTGCGGTGGCCATTGGTGCGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGCGAGGGAATTGGAAAATGAGCTGCTCGCTGGTGCATGTGAGCTGGTTGCTGG
TGAGCGGACAGCAACGAGCTGGGCGCATCAAGTGGCTCTCGGATGACCCAAGGTATGAGCGCTTTCCATTGTCTTGTGGACATTGAGGCCACTAAGGAAT
AGCTACAGTTGCTCTATTCACGAGTGGTCGTCATGCCAGACGTGTGCCATTGCATATCAGCGGGTCGTTTCAATCAGTGTGGCACATGTCGCAGTTCTGA
GAATAAGATCTGAGTTTGATGTTGTAAACATGGCTACATTTAGAAGCGCTACTTGATGGTGCGAACTTAAGAAGTGGGAAGGACTGTCCACGGTCGCGTA
CCACTGGCTTGGTGAAATCGAGCGTCACATGCGCCCAAGAGCATACGTATGCCCACCTGTGCTTCGCCTACAGCCTCTACCACAACTCACAAGCGGCCCT
TGCCACACCCATGGAGCTCGTCACCCTTGACGGCGATGTGGTTGGTGGTCGCGCTGAGAAAATCGGGGACGAAGCCGGAGTGGTGACTGGCCTTGGCCAT
ACACACATTGCCCATTCGAAGTCTTGGTGTTGAAGCAACACGCGGCGTACATGACCGTTGTGTGGCTCGTAGCATGCTGGCAGGTCCGGGTACTTGTCCG
CGTCACCGCCAACCTCGGTCGCTCGAGATGAAGCGCTCATACCAAAGCGACCAGTTTTTGTTACAGTGTTGCGAGCACGACCAGCTTCTGGCGCATACCT
ACAACTCATGCACCACAAGATTATTCAGTTGCGTAGGCAAGTTTGTCTGCGTAGCACATGGGATTTTTTTCTCGATCGCGGTTTTTTTCCCAAGTCTAAA
CATTTTTTCTTCAGTTCAAATTGATTGTGACAGCCACATCATCAGCTCCCAAGCACTCCAAGGGCCATCACAACTCCATCAGCACCATCGAGCGTAACCA
TGACAAGCAACCAACCACACGCAACCAGCATGAGCACGTCGTCGCCATCATCAGCTCAGTGGTACGCCGACCCCGCCGCCTTTGAGGAGTAC