Description :
From Genome Similarity Track
Location :
Scaffold_170:55548- 56938
Transcript NameFunction/comments
g6174.t1hypothetical protein

Sequence
1390 bases(100 bases per row)
CTGCAGCAGTCAGCATTGTTCCTGTGTGTATCCGATAGGAAGAGTTCTAGCCGGCTGGAAGGCAAATTAGAGAGTGAGTACAAATTAACGCAAAGCGTGA
TACACACGAGGCGTATACGATACCCTTAAGCTTACGTTCACTATCACTGGAGACTTGATGGAGGGTAGCCCGTACGTAATGGCAAGCTCACATCTTGAGA
TCAAAAAGTGTAAAATCTCGGCGGCACCGAAAACCAGATGGTGGATAATGAGCTTCTGACGGAGGTTCTGTGCCAAACAAAAGTCAATGACGTTCCGACG
ATGCGCTGTGGCATTCTCGATTGGCAGGTGGAGCATAGGACTCGATCACGAATACCACCAGACTTTCCGGTGGGGACGCGCTTTTACGCTTCTTTACAAA
CGTGTCGAGACTTCAGGGGCTTTAGCCGTCACTGATACACCTTTTTTTCTGTTTGAACGCTTTCAGACAGCGAAATCGAACACTGTCTTATCTTCTCGCT
GAGAACTCGAGGGAGTTGAAGGAACGTTGATGCGCAAGGTACATGCATCGTATCATTTACTCTGTCGCCGACTTCAATGCGACTCGCAGTGAAGTGCATC
AAGATACGTCATTCGTAGCGTTGTGGTGTTGGTAAACGCCGTGAGGATAAATTAAGCCCTGGGGCCCAGACACTAGATTATCCCCCAGGCTAACGAACCT
ATATTCGCATTTATATGAGACGGTATCCGCCAGGAGGCTTCAATACGGTTTTGCTGGCTGATCGATCATGATCAAGCGCATCGGGCTGGCGGACGCAACT
GTAAAATCGCTACGGCCACAATGTGACGCCAATACACCAGCTTTGCCGTTCACAAAGGCGTCCTGTGCTAGCAATAACTAAACGCCGGTGAAACTGCATC
CAGCAAACGTGTACGGTAGCTTTGCCTCGCTGTGCGTTCTAATCTCGGATCGATAAATAATGGACCGATTCCCGCAGCATTTTCCCGCCAGCTACCATTG
ATTGGTATTGTAAACCTCGTCTCCTACATCGCAATACAAACCTGGCCAACTTAGTACCTGATATATCTTCGTGAACTTAATCACTTCTCGATCCACCGAC
TCGGCAGTCAAGCTTAACATTTTGCTTTTACATTTGCTATATGAAAAGTATGTACTTTCATACTTGTTCAACACCACAGATCACATACTCGGATCGATGT
CTGCGTCCACGCTGTTTCCTTCTATTCACGTTGCTGGCTCCGCAGTCACTCCTGCAGTATCCGAAGGCCAGACAACACCTTCCTATAGCCGACGAGCTTT
CTCCTTAACTAGAACCCCGGTAAGACTAATCGTTTGGCTTGATACTGCAGCATCCAATTCACAAGCGCGTCACCCACAGTAGGATGCGCC