Description :
From Genome Similarity Track
Location :
Scaffold_528:5554- 10769
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_528-fgenesh-gene-0.1Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_528-fgenesh-gene-0.4SET domain protein 123 (ISS)
Pytar_ATCC12531maker-par_contig_528-fgenesh-gene-0.2Tigger transposable element derived 6
Pytar_ATCC12531maker-par_contig_528-fgenesh-gene-0.5Conserved gene of unknown function

Sequence
5215 bases(100 bases per row)
ATGACGGTGGGCGGCGACGCGGCGCTGTGGCACTTGGCCGAGGGCATCTCGTGCCACGCGTGGAACAAGGACCGCTCCAAGGTGGCCATTTGCCCCAACA
CGAATGAGATCTGGGTCTACTCAGGCTGCCAGAACGCCGACGCCACCAAGTGGCGCAAAGAGGCCGTGCTCACGGAGCACGACATGGTCGTGAGCGGACT
CGACTGGTCGCCCGTGACCGATCTGCTCGTCTCGTGCTCGCACGACCGCGGCGCGTTTGTGTGGAAGTACGACCCGCAGTTCCGCAAGTGGAACCCGACG
CTCGTCGTGCTGCGTATCGCACGCGCTGCGATCAACGTCAAGTGGAGTCCCAATGGTACGGGAATGTTATATGTTGTAAGCGTACGTGGGCATACGACTC
ATGGGCGGGAGTGGTGTCGTAGGCCAGAAGTTTGCTGTCACGAGCGGCGCCAAGTGCGTGGCTGTGTGCACGTACCAGGCCTCAGAGAACTGGTGGGTCA
GCAAGATCATCAAGAAGCACAAGTCCACGTACGTTGCCGTGCATGGAGCGAATCCCCCCCTGGGTCGTCTTTTGTATGTAACTGATCTCTCTTGGTGGAC
AGGGTCACGGACTTGAGCTGGCACCCCAACAGCCAGCTCCTGGCGACCGCCAGCACGGACCTCAAGTGCCGCGTCTTTTCGGCCTACATCCCCGAAGTCG
ACAGCACACCAGATGCCGGACCGTTTCCGCAGCTCGCGGCGTTTGGCGAGCCGCTGGCCGAGTTTGACAATGCAAGTGCCTGGGTCAACGCCGTCGCGTG
GTCGCCGCAGGGCAACCGCCTGGCGTTTGCCGGCCACGGCTCGTCGATCCACTTCGTGCATTTCGGCCGACCGGGCGAGTACCCGACGGTGCAGTCGATC
CGGTTCTCGCAGCTGCCGCTCAACAAGATTTTGTTTCTCTCGAACGACGCGCTGGTGGGCGCCGGCTACGAGTTCAACGTGCTGCTCTTTGCGACCGACG
CCGCCAACAGCTTTTGGTCGCTTCAAGAACTGCTCGACAAGAAACCCGCGGAATCGGCCATCAAGCGTGACTCGGGCAGCTTCAATGCCGCTCGCCACAT
GTGGGAGAGCAAGGTCTCGCGCGGTCAGTCGTCGGACGCGACCAACAGCGACAAGGGCGCGCTCTGGACCAAGCACGAGAGCGCCATCACGGACATTCAG
CCGTACGACCGCACGGCCTCGGGGAGCATCTCGGCGTTCACGACCTCGGGTACGTTCTTTCGTATTCAATTTAGAACTGGGTTGCAACTCACACTTGTTG
TGGATTCTTCTAGCGCTCGATGGTCGCATTGTGCTGTGGCCGCTCCAGAGTCTCAACGTGCAAATGGCCAAGCTGCGTCTGTAGGCAAAAGCGCCCCGAC
GACCACGGGTCTCAACGACACTCAGAGAAAAAGAGAGAGAGACCCAGCCAATTAAAAAGTCAATCCACTGGGGATGACGTGCACTTTCTCTAAGAACCTT
CTACGTACTACTCGTAGAGGCGCTTTATCCTGCGGTAGTCCTGTCGGTACTGGTTCTCGACAAACGACGCCTCGCGAAAGTCTTTCCACTCGGGGAACTC
GGCCAGCAGCACGGCCGCGTCCAGCGCGAGCAGCAGCTGAATGCCCTGGCTCACGTCGTTGAGCGTGCGCGCGAGGTCGACGTGGTCCCCATTCAGATAC
GTCTTCTGCAGCTCAAGTAGTTCGTAGCTGCTCCGCAAGAAGAGGATGGCGTACTCGCGCACGTCCTGGCTCGGCCGCGACTTGAGGATCTCGTCGCAGC
AGTCGGCCACGAGCTTGTGGATGCGGATGAGCACGACGTGGTCATGGGCGACAATCTCGAGCGCGTCCGACAGGGCGTTCAACGCGACGGCCAGGACGTG
TGCACCGTCGCCGCGCGTCTTGAGCATGTCCTCGGCCGTGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCGGCGCCGGCGGAGTCGGCAGCACGCTGTCGCCGCGTGCGCACAGTGCGCAGCCGCAGTCAAAGCCAAACTGGTCCCGCAGATTC
GCGCGCCGCTTGGCTCGGCTCTGCTCGCGCGGGTACAAGTACGAGATCGTGAGCGGCTCGCCCTTGCGGATCTTCTGGGCCACGCGCACTTCGGAGACGC
CCGCGTGGGCCTTCTCGGGCGTAAACTTGACGCAGTTGGGGTTGCAGTCGTGGTTGAAAATGGCGTTGAAGAGGAAGACGCCACTGTCAAAGGCGTTGCA
CTGCATGCCAAAGACGTTTTGCAGGAGCTGGTCGTGCGAGAAGCCCAGGGACGCAAAGCGCTCGCGCAGTTGCTCGAGCGGCGCGCCGTACTTTGCGCGC
CCGGCCTGCAGCATGTCGGCGGGGAGATCCGAGAGCTGGACGGGGTGCAAGTGGCTCAGGTGCGCGACAATGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGGGGCGGTTGAGGATGCTCTCCATGGCGACAATGAAAAACGACGGGTCCGACTGGTCCACGTCGCTCG
TGGGCCATGGAACGTAGACGTGTTCCATGAGCACGAGCGTTCCCGGCTCGAGGTCCTCGCTCGCGACGTAGCCACGGCCACCGCCGATACCCGCGCACTC
GGTAGCAATCTCGATGGGGCCGACGTACGTGGGGCGCACGTCCTCCCACGCCGCGTAGAGCGGCCGCGTCGAGGACGGCCGCAAGGTCGGAGCTGCTGGC
GTTGCTACCGCCGGAGCCACTGGTTTCATGATCTTCAGAGAAGCCACTGGCGCTGGCGCCACGGGCACCACGGGCGTGATCTCATTGCGCTCGCCCTCGT
CCTCGCTGCTGTCGTCGTCAAAGAGCCCGAAGGCCGCCTGCACCGAGTCGCTCATGGTCGCCCTCGTGGGTCTTCTCACTCAATCGCTGGGCGAAGCCAT
TCATATCCGCGTGTCGAGAATACCCGTCCAGAATGTCGATATTGTCAATAATATAAATGAGGTTTTAAGGTTTTATCGCTATTTTTCCCCTGGTTCTGTG
GTCTCCATGGGGCAAAGTCGCTAAAGCCGAGGAGAGACCTCCCCGCAAGAGACCTCCCCATGGACGCGCCAGGAGCTCTTCATGGCGGGGCGCCTGTCTC
TGGCCGCAAGCNNNNNNNNNNNNNNNNGCGCGCCGTGGACTCGCTGGACATGGCGACCGAGGTGCTCACGGGCGGCGTGGTGGAGCGTGGCGACATGGCG
GACGAAGAGGACGACGAGATGGGCGGAGAGGACGGCGAGATGGGGGACGAGGAGGAGGAGGACGACGACGACGACATGGCCCACGGCGGAGCAGACGCCG
GAGGAGCGGACGGCGGCGGCGCGCTGCCCGCTGGACGCCGCATGCGGCTCACGCTCGGCCAGAAGCGCGAGGTCGTGGACTTGGCCGCGAGCAAGAAGTT
CACGCACAAGGAGCTGGCCGAGAAGTTCCACGTCGGGCGCACGACCATCACCAACATTTGCCGCCAAGAGGATCTCATTCGCACCGAGACGGACTCGGCG
GACGCGACCAAGAAGAAGCGCAAGACGACCAAGTGCACGTACGACTTGCGCGTGCTGGACGAGTGTCTCCACAAGTGGCGCATGGAGGTCAAGGTGAGCT
CCCCGGATACCAAGCTCACGGGCACGGTGCTCCAGCAAAAGGCCATGGACATTGCCATGAAGATTCTCCAGGAGCCGTACGCCGACCTGCCCGACAAGGT
GCGCCACGCGCTCGCCAAGTTCAGTGCCTCGAACGGCTGGCTCGACGGCTACCGCACGCGCTTCGGCTCGTTCAGCTCCAAGCAGCTTCACGGCGAGGCG
AGCGTGATCAAGAACGTCGACATCCAGACGCGGCTCCGCGAGATCCACCACAGCCTCACGGGCGTCGACGTGCAGGACATTTGGACGGGCAGCGAGTTTG
CCGTAGCGTTCAAGCCCAATGCCGGCGCGGCCGCGGCCATGGCCGACGCGGCGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTAACGGACGCTACACGGTCTCTCTGTTTGTGAGCGCCGCGGGTGAGAAGTTTGACATGCAAGTGATCGGCGTGGACCGGTCACCCGTGCTGCTCGA
GGGCGTGGACACGCAGGCCATGTACCGTATCCATTATGGCCACTCCAAGACAGGCTGGCAGGTGGCCCACACCATGGTGACCATGCTCAAGGCGCTCAAC
GCGCTGGCCAAGAAGCGCAAGCGCACGTTCCGCGTCATTCTCGACAGCGCCGTGCCGCACGTCAAGGCCGCCATGCTGCTCGACTCGCAGGGCGACCAGC
GCACGTTCTTCGTCTTTGACCACTTGCAGCTCTACTTTTTGCCGCCCAATTTCAAGCCGCCGCGGTTCCACCCGCTCCACTTGGGCATCGTGCAGGCCTT
CAAGGCGCGGTTCCGGTACGAGCTGCTCGAGACGCTCTTCACCAACTATCGCCAGTGCGTGCTCACGCAGGACATGCACGGCTTCCACCCAGCGCGCCAC
TTGCACTCGCGCAACGTCTTTCACTGGCTCTACATTGCGCTCCACAGTCTCGACGCGCACTTGATCCAGAACTGCTGGGTGCAGAGCGGTCTCTTGCCCA
CGCAGGTCATTGCGAATCTCAACATGAAGGAGATTCTCCAGGCCTCGGGCGGAGCCACGGCCAAGAACTCGCCGTCCCAGGTCGTGGCCAATGTCGCGCC
CTTGTACAAGGACCTGCAGACGCTCATGGTCCAGATCTCGCAGCTCGCGCCCGATTTCCTGCACTGGGTCGGCGTCGGTGATCCGGCGAATGCACAGGCC
TATGTCGAGATGGAAGGGAACGCGTCCGTGACGGATCCGGGCATCGACGAAGTGCAGATCATCCGTAGCGTGCTGCAAAAGCACGGGTTCCTCTCGACCA
AGCGGCTCGACGACGCCACGCACGCGTCGGGCCACTTTGAGTCGCTTGCCGACGTCGCCGACGAGCCGACGCCGCGGCCCGAGGACGTGCTCACGTCGAT
TGGCATCCTCAAGCGGTACCTGCGGCTTACGCACGACACGATCCCGGACCGCGTCGAGGCCGTCGTGCAGCTCAACAAGATCAAGGCCAACTTGGGCAAC
GCCCACGCGGCCGCC