Description :
From Genome Similarity Track
Location :
Scaffold_22:5554- 10405
Sequence
4851 bases(100 bases per row)
GAACCCCCATATCTCTGCACGCTCCGAAAAATACATTTCCAGTGACAGAACCGTCGTATGCGTTGGTAGGTACACCCAATTCCTTGATGACCCCCTTTTA
AACTCTTATGGTAGTGGTGGAGCAAGTTAGTCTGGAGACTTTCCGGTACCACCAGTCTGACCGTCATGTCGCGGCCTTCTCCCTCGACTATAGAGTTGGA
CAATACACCAACAATCCTTACTCGCTGATATCGTAATCTTCGTACATTTTGCTACACTTTTTAGCGGATTCTACCGACAGGTCTCTTCAGTCCGCCTTCA
AATATGCATTCGAATCTCCTACCCAGCTCTCCTCTTCTTGCGCCTTTCGAATTCGTTGCATGGTCCCTCCAGATATCTCAATAGGAGATCGCGACTGAAT
TACCACAAATATTTTAGTATAGAGACTCTGGTCTTTAGGAGCTAGCAGCTCATCAGACGATTGATCACGTCCAATCCTGGTCTTTCTTCACTCGGCATAG
ACTTGATCTCCCCTTTCTGGTACAAGGCTGTACTAGCCAACTGATTTGCGCTTCCTGGTTCCAGTCTCGTTTCACATGCTGGATCCCGTGAGAAGTCCAC
GATTGGAGTTCATTTGAAGCCCGGTCTCGCAGTGATGATAGACCCTAGGCCTTACACTTAATCTCCCGTCGCATATGCCGTACCACTAATTTGGAGTCTC
CACAGATAATCAACCGCCGCCGCTCCAAAGTTTTCAATAAGCTAAATCCAAGCAACATACTATCATATTCTGCCTTATTTACCGTAGATGTATCGACATA
TTTGGAGGCGGCTTCGACTATGGTCCAAGCTGAGAGTCTCCATACGATAGCGCTAAAAGCCCCGCCTCCTTGCTTAACACGGGCCAACCCATCAAAACGC
ATTACATATAGTTCTTCTTCCGGTTCTACGGTTGGGGTGGGTAGGTTGATCGTCTGCCATGCCTGATTCTTAGGGGCAATGGCCGACAATATTGAGTCTG
CACTCTATCGAAGGGTAATACTAGCTTTCAATGCCCCCAACACCTGGTCTTCACCTTTTTACACTTCACGATCTCCAAGGTCCACTGAGCCTAGAGAGCG
TCCCAGTTTCCCAAACGCCCCTGCAAGCCGGCAGATTTCACTAACTACGTCAATGTCGAGTATCACGTCAAGACTTTTAGGGGCTGAGTGACCAACATGG
TGAAGCAAGTTTCCAGTATACGTAATAAGACTAACACTTCTTCCTCTACACTACTGTAATATAATTCGTTAGCCTTGAGAGTTATGCTTGTAAAAGCCGG
CATAAGCAGTTCTTCATAATACTTTACCAGTGACGCCGAAATGGCCCATTCACTTGCATAGACAATAATCATGGCTTCTCTGGTCGGGTTGAAGTTTCTC
AGAATTGGCGCCGTGGCAATTTTATTCTTAAGCATGGCGAAGGCCACTTGGACACGGTCCACCTTTCTTCTTGTTCATCCTGGAAGTGGCATTGTTATCT
CGTTTTAACTGGTTTCGTCGGGCATGAAAGTCCACCTAGCTCAGTTCTTAGAGAATAGATGCATATACTGCATAGTCTTCAATAAACCTGCTATAGTAGT
TCGATCTTCCTAGATAGGATTGCATAGCTTCAGTGTCATTGGTAAAGGTAGGTCGACTAGAGATTGAAGATCTTTCGGGTGAGCCTCTAGTCCTCCACTA
GATACTCGATGCCCAAGGTAGTCGATCTTCCGACATCCCCACAAACCCTTGACTGCGCAGATCGACAAATTCCAGTAGTCGCACACATCAAGCAGTCGTT
CCACTTTTGTGCACAACGCATCCTATGATTCGACAGGGATGTAATCTATATATGACCGCCGACTCAGGATCGAGGAACTAGACTGCTCATCTGGCTCTCT
CACCTTTAACAAATCCTCTGACACATCTGCCTCTGCTTCTGGAGGTATTCGCAAAAAACCATATAGAGCGTTATTCAGGAGTTGCTAATATATTTGGTGC
GCGTTCTTAAGCCCAAACGGCATCCGCATCCATTCAATCAGACCCAGTGGAGGCAATGAACGCCAAAATTTTTGGCTCTCTCTCTCATTCATACCTAGAA
ACCACTTGCCATGTCAAGCGAGAAGTACGACAATGCTCAATCCAAGTTTTCGAATAATTCATTAATCAAAGACATGGGATAGACCTAAGTTGAGTCAGGT
CATTTACCAACCTATAGTCGATGCACATCCTGATGTCCACCTCATTTTTCTTCACAATAATAACAAATGGGTTGGCCCAGGGTGAGTTAGACGTCTGTAC
AATTATCACAGATAACATCCCCTTGATCAGGTCGTCCAACTTCTTCTTGAATTGAAGACCACTTTTTGTGCGCGTTGCACGTTGCGAATCGGATTTGCAT
TTCCCACATCAATATCATATATATCCCCTCGGCCGGCTGGCGGTAAGGCATCCACTTTTCCTATCAGCAGATGTCGTCTTTTCCATATAATCTGTCGTAG
CGAGTCGACATCTTCTGGATTGATCCCATCCGGATCAGGAATCTGTATATCTTTTAACCCAATAGTCTCAGAGCAGGAGCCCATCTCCGGTATTATTACC
CATCATCGTTTATGTCTTCAGCCCACAAGTCTCTACTTTAGAACGTATAAACTTGTTCATCGTCCCGTAGCGATTCATTGGCCTAGGCTTTTTCCTCATT
GACTGCGATCTCTACCAGTGGATCGCCTTTGGGACCACTTCGTTCTTGAGGGATTTCTTCTCGTAGAAGTACCTCTTCTTCGCGTGACTGTTCTTTTCTC
TCTGGTAGCGGCTGGTGTGACACCCCACAATTCATCATTTGGACTTAGGTCTTTGAACGTTGCAAAATATGCGACGGGATATTGTACTGCGGTGTATCCA
CCAGTGGTGTTTCTTCTCCTTCCTCGAGGTCAACTTGGGGGTCGAGATGGTCAGTGGTTGCTTCATACGCTAGATTCATCCACTCAGCGTACCTTCAAAA
ACTCACTGAGACGAAATCTTGTGCTCTTGGTACTTGATTCTACGTCAGCCACATACCTATCTTGGTGCCATCATGTGATATCAACGTGTGGGGGCTGACG
TTGGTCACCTTCATCAATTGTCGGCGTTCTATCCCCCGGGTCATTGTTGTAACCCGTCCCTCTCCTCTTGTGGCCCACATCTTCCATTGTTCTGAGGTCA
ACCTCTTTAGAGGTATTTCCACACACCCACCAGCAAGTATACACATATTGTCCCAACCTCACGTCTGAGACTCGGTTATTGTAGACGGTCCTCAGTCCAG
AGAGTTGTATCCGGACTTCGTTAGAGAGGCAGAGTGTTTTATCCACCAGGTCTAGCTGGATAACATCCGGGACCATGAAGTCCATTCCCAAAATCGCATC
CTGAACCACCATAGGGCCTACCTACACCTTGAAAACGTACACTAAATTTCCATTTAGGGTGACCTTGATGCGAGTGCGCCCTTCCCGTGAAAGCACACCA
TTCCCCGATGCCAATGCACTCTTTTTGTTCGCTTTTGACAATTTGACAGCCTATCTTACAAGCAAAGGCGACATCCAAAATGGATATCTCGGCGCCTGTA
TCGAACAACAAATTATCGCGATCGTTGTTGATCTCCCCCGATGCTTTGGCTTGTTTAATCCACTTAGTAGGGGCATGATATTTCCAGTATCCTCTGGATT
CTCCAGGCAGTAGTTCTAACTCCATCATTGCTTTTTCTCGGGCGAAATCATTAGGTTCACTGAGAGAGACAACATGGTCCATAGGGTATTCTACAATCTC
CGATGTACTATCGATCTTCTCAGTGGAAACCCCCCTCTCCTCTATGGGCTGCTTTTCCACGTATGCAACGATACAAAGACTAGAACGCTCGACTCATACC
AGATTCAACCTGGCGAGCGTTCTAATTTATCATCTTTTTCAACTTTCTCCGGCAACATTCCGGCGTGCTTGGTGGGGTTGTACCATTGACGAATCAAATT
GTAGAAGTCCTCTAGCTGGCATTTCCCCGCTTCATGGATGTCTCCGCATACACGACACACGAACGAGCAGCGATCTGATGGGTTACCCTTCTTCCTGCAG
TGGTCACACGTTATTCTCTTCCAGCACCTCAATTCTCCATGTTTTCTGGATCCGCAGTGTGTATATCACACGTTCATCTCGGCCGACGTATTGCGAGGTA
CCGGGTCTTCTGCTTGTTTCCGATGTTGGTCGGCCTCTCTGGTGGGTCGCTATCTCATGGTTCTTGAACTAGGGTCCTTTTCCGCTTCCGCTAGGTAGAT
TCGTCTCAGGTCTCCCTTGTTATCCGAATCATCCAGGCTGGATACCTCCGAGCTCGACTCTTCTAGGGCCGCTCGAACTGCATGCACGGAACGGAGGTTT
GCATCTCTGGGTCGATCCGGAGGAGCTGGCACCTTCTGCCGGAACTTGATGGAAAAAACCAGCGTCTTTCCACGCCATGCCTTCGTCTTCTGGCTCGCCT
TCAATAATTTGTCCAGGTCTTCCACGTCTGCCAGACGTAGCATCGTCAACTGGTCTGCCAACTCTGGGTCGTCCACGGCATCGATGTAATGCTCGACATG
TTCCTAATGGATCTTGGGCAATCCATCTTTGATCTTCAGCTTCTCCCTGAAAAAATGACGTTTAGGTGGTACAGGTAGTCCAACGGGTATTCGCCTGACC
TTTTCTTCGCGTGGTAGTACTGGCGGGCAACTGGTACCCCCAGATGACAAAACTGCAGCTGGAATTCTTGCAGCAGGTCTTTTCAATTTCCTCGAGCGAA
GCGGACCAATTGGCGATACCATTTCTGAGCCGGCCCGATCAGCAGTCCTTT