Description :
From Genome Similarity Track
Location :
Scaffold_24:555279- 556679
Transcript NameFunction/comments
Physo_133173hypothetical protein

Sequence
1400 bases(100 bases per row)
TGTAGTGGGCCTACTTTGGCTCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTAAATTAGAGTTAATTATACTCGGGC
CACCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGATAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATG
TAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAAAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGTAAGAGATGCTGCTCTTAGCCAAT
AGGAATCCAAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTTTCTACACCAAGGTCGAGAAAGTCTTTCGAACCTCT
AACAGACGTCGTATCTGTTAGAGTTACAAGTGACTGTAGCCACTTGTGCGTGTTACCCTGTTACACCATCCCCCCCTCAAGGTTAGACGCGCCGAGTCAC
GGCACGTCAATCAGGAAATTGACCATTCGTCAATTCTTCACGTTGGGAGAAAGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCGCAGAAGAAGACCGC
CGCCGCAACAGAGGGTAACCTCTCTGTTGCTCAATACCATGAGCGCCAGCAGGCAAAGCGCGACGCGCTCGCTGCAAAGGCCGCGTCGGGGACAACTCAG
TCGGAGATTGTTCTCGAAGGTTCCTCTGTAGTCAACGACGCCGTTGACTATGGGAGTGACGACGAAGAGATGGAAGAGGGCGAGGCCTCTTCCAACAAGC
GCAAGGAGTCTATCGACAGTGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCGTGAAGGAGACGACTCGGACGCTTCGAGCTCGAAGCGTTCGCG
CGGCGAGAGCGAAACTCCGCTCTCCGCTGCTGGGGCTTTAAGCTCCCCGCGTGAGGTGTCGTCTTCAAGTTTTCCGCGCGCTGCTCAGGCAGCGCGCGAT
CCGTGGACGCCGTCTGCGTCAGAGATCGCAGACCGTGTGGGCAACACCGTGCCTCCAAATGAAATTCCGCTGTACGTATGCAGCGGGATCCACGATGATG
CTGTGGCGGAGGAGTAGCACTTTGATCCGTTAACGAATCAAAGGCGCGATTACTATATCGGACTCTTTCACGAGCTCCGATACTTCTCCAGCAAGAAGAC
CTCTTCTCGCAGCAAAGTGCCTAAGTGGCAGGCACTTTGTCAAAGTTGGAATGCTTTTGTTGAGAACTTCAAGAAGAAGCCGGCTGCTTACCGTGAGCGG
GTTAAGCATGCCCGTGAGCGCTTCGAGACATTCTCGACGCGCGGGAGGCTGGAGCAGCTCCACAGATCCTCTGTGGACGCTGGTATTCCGTGCGCTGTGC