Description :
From Genome Similarity Track
Location :
Scaffold_401:5552- 7734
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_401-snap-gene-0.18Conserved gene of unknown function

Sequence
2182 bases(100 bases per row)
CGAGACCTGATGCGGCGCCCGCGGTTGTATCAGCACCTGCGNNNNNNNNNNNNNNNNNNCTGGCGCACCTGTCGGATCAACTGCATGAACTGGATGATCT
CCTGGGACGCCAGCGCCACGTTGCGGTGGTTCTCGCAGAACGCGGCGATGTTGCGCTCGCCAGCGTCCAGATCCTCTACGGGCACATCGCGGACCTTTTG
GCGAAACACGATGAAAAGAGTCTACAATGGTATGCACGTCGTCAGTCTGGAGCTCTTTGCTGAAGAGATCACATTAGACATCATGAGCGTACCGGTATTA
TTTGCTCGACGGTGGCCTCAAACTCGGCGTTCGCTTTCTCCTTGGTGACGATCGCGATGCAGCATTTCAAAATCTCACCCGCGAAGCTCTCGGGGTACCA
GCGCAGACACAGGTCGAGAATCTCGCGCTGGATGTGCACGTGATGCGCGTCTAACACTGGCGCCACGTTGAGAAACAGCTGCACGGCTCCGTCTCGGCAA
CTGGCGTCTGCTTGATGGCGAGCGATGGAGGCGCCAACGAGCCTCCAAATCTGATCAATCAGCGCAAGCGCCTGCTCGGGTGCCTGCACGCCGCTGATCG
CTCGGCCAAGCAACGCGATCGCACTTGCGCATTCGTCGGCATGAGAGCTCTGCATGGACGTCGTGATTGACGTGAGCACGGCATTGCAGAAGTTGGCAAA
GTCTACGAAAAAAATCAGCCCGTCAGCAACAGACTGAGAGCACACAAGGGAAAGAGAGAGTGTGACGTACCGGCATTTGAGATCCCGCCCATCGTACGGA
ACGTGGCCTCCAACAAATCACCTCTGGCAGAAATCGACACATCTGGCGTAGGACTTGTGCTACTGACGGTCAACAGCGTTTGCAGTAACTCAGCACGCTC
GCTGACCTCAGTGTATTTGCTGTTAGGTTGCATGCAAAGCCACACGATGAGTTTATAGGATTCATAAAATGATAGTTTAAAGACGGGAAGGTGTACCTGA
TACTGTTGCTGTTCTGCAGCAACGCCTGCGCCACCACCGCAAACGATGCTGCAAAGTTAAGACCGCGACACAAGTTTAACGACGCCTGAAGGTACACATC
GCTGGGCAACACGACGGCAGCGCTTAACGAGCGGAGGTATCTACAGTACGCAACAATGCAGAGTGTCATAGAAAACTCCACACCAGCGCCTTTCATAGGT
ATCCACACTTCACCTTGCGATCCCATTCATGATCAGCGGATGGTTTGGCAGCGTGTGCGCGCTCGTTAGAACAGATTGCAGCAGCAGAATGCCTTCACCT
GACCGTGCGACGAGCTCTAGTTCACTATCGGATTCCGAGTCAGACGAGTCGATATCGAAAAGCTCAATCATGTACTCGAGCAGAAACAGAGTCGCGTCGG
CCAGCGCAATGTCCGTGGAGGTGTACAGGAGATCGATCATCCCCTTTACGCACGCATGGTAGTTCCCGTTTGGCTCGCCGTGGAGACCCGGCCACTTTGA
GAACAGGCTGAGCAGCGTATCAGCGATGTCCCTGCGCACATATTGGTTGGCATTGAAGTCAGACTCAAAGATACCGCACCAGAGAAAGTCATGACCAATT
TTTCCTACCTACGGATCGCGGCGATGGCTTCAACGTCAGCATCATCGCTTGTGAGCTCTTGGGTCTCGACAAACCACTGCGGGTATCGACAGTGGTCGAT
CAGCGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCTGGACAACGTGCTCCTGCTCGGTGACACTCGTGAGCAAGTGCCAGAGCGATCCGCT
CTTGGTGCTCTGATCGAGGAAGAAGAACCAGAATTCGAGTGTCGGTTCCATAACTTCGATGTCTTTGTGGGACGAGCACCCCAATAAATATTCCAGAAAC
GCAGAGCTGAACGAGTCCTGAGTAGCGTCAAAATCCATGCGCGTCATCGCCTCGTTCATCTCGCGCGATAGCAGCGTCGCCGTGTGGTTGATGGCCAATG
AGCATGCGATCCGAGACAAACCGCGGCAAATGGTCGTTTGTGGGGCTTCGTCCGTGTCCTCCAATCCCGATGTTATTGTGGTCGCTTGGCCGAATATTAG
GGGTCTCGTCTGGAGAAGACGATGCGCCGTGTAGCAGACGACTTCAATGATGGTACCGCCTGCAAGCTCCGGCGATATGCTC