Description :
From Genome Similarity Track
Location :
Scaffold_48:55502- 58533
Transcript NameFunction/comments
Phymu_g2623conserved hypothetical protein
Phymu_g2624mitogen-activated protein kinase, putative

Sequence
3031 bases(100 bases per row)
GCACGCCTAGAGCGACGGTCATGTTGtaaccagcttcagcaatgGCCAGACCAAAGTTGGTGGAGCCGAACTTGGAGATGTACGTGCGGACGGAGCTGAA
CCCGTGGCCTCGGATGGTCGCGATGTCGTCCTTGACGCTTTGAGCGGTCATGGCGCCGGCCGCGTATCCGTGATCGGGGTCGTAGCAGACGCCGTTGGCG
GTCACTTGAGCTACGAGCATCGCGATGGCCGTGAGAATTGGGACGAAGCACTTCATGCTCAAAAGGTTCTTGGACTGGATGTGTGCAGTTGAAAGCAGGT
GGGGAAGTGATCTCGGAAACAATGACGTCCGGCTTCAAAGGAGCTTCGAACACTAATTTTTAGGCGGTCGAGCGATGGCGAAGTATCCAGTGGCGTGCCG
TGTAACAGCTCGAATTCTACGAGAGCGCACGCACTAGGCGCCTTTGGTCGAACCTCGACAGGCATTGGAGACTTTGGAGGTGGCTGCGCATGCTTGGAAC
GAGGCTCGAAGCACTGAAACTCCCGTCGAAACTGACCCGACGCAGGTGGGTCCAGCACGCGCGAAATTCAAATCTGTTAGTGCTGAGGACACAACTGCAC
AACGGAGATGTATTTTGGCGATGGCGATAGCGCCTGTGCCCATGAAGAGCCACATTTCGGCCGCGTTGTCACACGACAGGCGCTACTGTAGCTGCATCAA
AAAGCGTCGGAGTTGCAGCTTAGTGTTATTATTTTACTGATATCTTCCTGGTTAACTTGCGGAGGCGGTCATCCCCATtcggaagaagcggctggCAGCG
GTGCTCAGTGGAATCGGCGCAACGGAGACCGGCACGGGAGGGTGGAACTGCTCAATATCCTCGCACAGCAGGTCGATGAGCGCATCCTTGGACAACTGAT
CGTCGGCCAGATCGAACGAAAAGTCGAACGGCTTGGAGAGAACCAGGTCGTTTTCGTCGAAGAACGTCGCCAAATACGGGTGTCGTAGTGCCGCGTCCAC
TGAGATGCGCTTGTCCGGGTTAAACATCAGCATTTTGCTCAATAAATCCGTCGCCTCTGAGCTCACGGCGTTTTCAGCGCCACTCCCAACAAAAACATCC
CTCCATTTCTTCGGTTTGGAGATCGCCAGCTTGGTCAGGAACCGTAGAGCCTTCGTGTTCTTCACAAAGCTGATGTCCTCCTGCTTTGGAGTGCCCAGGA
ACTTGATGATGAGCTTGAGTTGGTGTAAATAGTCATTGCCGGGAAACAGCGGCTCGCGCAAGAGCATTTCTGCAAAGATGCAGCCCACAGCCCATACGTC
GATCGCTGTCGAGTATTGCAAGCAGTTCAACATGATTTCCGGCGCTCGATACCATCGTGTCACAACGTATTCCGTGAGTTCGCCAGGGTGCGGCAGTTCG
CGATGAGCCCACGACGACAAGCCGACACCTCCGCGAGCGAGGCCGAAGTCGCACACTTTAAGGTCACAATTGGCGTTCAATAGAATGTTGCTGGGCTTCA
TATCGCGATGCAAAACACCGGCCGAGTGGATGTGGTGCAGGGCGCAGAGCATCTGGTACAAGAAGTACTTGACGTGGTCGTCCGACATGGGCTGCATGGA
GTAAATTACCTGGTGGAGATCGgtctccatgagctccgtGATAATATACATATCATCAAATTGCtttcgagaaggaggcggcgacagatccagcaggcGA
GTGATgttcttgtgcttgaagtGGCCCAGAAGCCGAACTTCACGTAGAATTCGCTTCGCGTCGACCAGGTCCTCGAAGATGTTCGTGATTTTCTTGACTG
CCAAGTTCTCACCCCCATTGACAACGTCCTTGACGGCGATCACAGCGCCGTACGCCCCGTTGCCGATTGGTTTAACTAGCTGGTAACGAGTATCCAAAGT
AAAAACTTGCCCGTTTGCGTTGAAGGAGTGAGTCTGTGATCGCATCATCGGGAATAagccagagctgctgctagaGGCACCAAATGCAGCACGCGGAAGA
CGCCCGTGTCCatttccagctgcaactgaCGATATCGTGCTGGCTTTGTTGTATTCGTCCTCCAGCCCCACGTTCTGGTAGACAGAAGCCCCTCTCCCTG
CTAAAACTGCACTTTTGTACGGTGCCGCTGAACTTTGTGTAGCAAGGTCACCCGCAACTGAGTCCTCTTCAGAGTCATCGCCCTGGTTGTCCTCCTGGTT
GCTGCTTTCCTTTGCGTCTGCTGCGTTGTTATCTGTGTCTCGACCTCGTGAATTCGATGACTCACTTGATCGATAGTCTGGCGTGCAGCAGTATCCGATG
TCAGCAGACGCAGGCAGCTCTTCCTGTGTGCTATCGGGAATGACTCGTGCTGTTGTCTGCATGTCGTGCGCCGCTGGTTTGGattcctcttcgtcctcgt
ctccCAAATCTTTTCTCGCTGCTCGAATCTCCTCCGCTGGGAAGTCGCTCTCGTCGAGGTTATTGTTGCTGCATTCACTACTGGTGCAGCTAATAGCACT
ACCATTGCGTTCCCGGTCCCTGGTCACCAGCACACTAGCTCTCCTGCCTTCGTCTCCAAACATAGGCACGATCTTTGCCGGTTCCGTTACTGCATTCCAC
CCTGTCGAGTCTCCGAGTCGGTACTGGGTCTCCGCCTGACTAATCAACTTGCTAATGCACGAATTCAACGTGTGCAGCCACTTACCGTGCGTCTGTTCAT
CCACCGCCGCCAGTCGGAGCACCTGTGAGCCGCTTTCTTCCTCTCTGTCTTCTGTTTCTGCGTCTGCGACTTCCGTGCGTTGATCCGGAGACcccaactg
cagctccagcacgtgttTCACCTGCTGGTGAGTCCTCAGATCCGTCACGACATCGTTCTGCGACAGCGTGACGATTGCCACGAGGTGACCGGGCTTCCTG
CTTTCAGGCTTGAACCGAAACTGTCTTAGCGTAAACTTCACGTGGGTGCCCAGCCCTCCTGCTCCGCTTGCCAACGTCTgttccagcacaaagtaGCAGG
GTCTGGAGCGCCAgtagcgctgctgcatcag