Description :
From Genome Similarity Track
Location :
Scaffold_1252:555- 2816
Transcript NameFunction/comments
Phyke_g12041hypothetical protein

Sequence
2261 bases(100 bases per row)
ggacgatgtggacgatgTCTTGAATCGCTCTTGGGACGCTCAGCGTGAGGCTGAGACGGCCCTGGAACGTGCGTTGCGGGCTGAGGAGGTAGCGACTGGT
CTTCGTCAGTCAAAccatgagctgctgacaCGTCTGCgaatgctggagcagaaaGTCTTCGGTCATGCCCAGACTGGGACGCGCCCGCGTGAGCGGGTGC
CTGGTTCAGATGGGTCCATGGCTCGTCGTGCGCGTCGGGAAGGGCGTCCGACTCACGTTGCGCAGATTCAGCTTGACGAGACGACTCTGGAATTGTAGCT
GGGTAATATCTCTTTAGGCGCCCGACGTAGAACGTCGGGTGTAGTCGTAGTGACGATGGGATGTCCAGCGTGTAAGCGTCTCCAATTACCTTTGTTACCT
TAAATGGTCCAATAAAGCGCGGGGCGAGTTTGCTCGCGCCAAGATTTGTTACTGCTGAGTTTCGAATACCGTCCGTCGACAGGAGTACACGCTCTCCTAT
CGTGAATGTGGCCATATTTTTCCTTCCGCGGATGTCTGCGTTCTCCTTCTGTTTGTCTACAGCTGTCTGCAGCGCATCACGTACGAATCGGGCGACCAAT
TGACGTTGGAGAATGAACTCCGATACTACCGCATTGTCCACTGGGTGGACCGACGACTTCGGCGCGTAGTTAGCCATGTGGGCATCCTCCTTGCGTGTTG
CACTCGCTGCACCAGGGTTTATCAGAGTCTGCGTagcccaagcagcaagagggGACGCCGTGCTTCGCGGCGCCGCGAGGATCTTCTTCGACTGGGAGCG
TGTGACAGCATTCATACTTACGGTCTTGTGAGCTGCACTCGGAGGCAATATCGGTGTGCCAGTAGTCACATTTTCCTCTCCGCCCAGAGTGAAGCCACGA
GGCGCCGTGGGATGACCCACGGCAAGCATAGCAGGAACGCGCGGGTGTCGTGCgttgttcacgaagaaggGCGTCAGCCCCGTTGATGCGTGCTGAGTAT
TGTTCAGGGCGAACTCTGCTAGGGGCAGGAACGAGCTCCAACTCGTGAACGACGTCGCATAACTACGAAGGACGTCTTCGAGGACTCGATTGACTCGCTC
TGTCTGACCGTCTGTCTCCGGGTGCGCCGCCGTCGACATCAAGAGCTTTGTCCCTAAAAGTTCGAACAACTTCGACCAAAAAGCTGATGTAAAACGCGGG
TCACGGTCCGAGACAATCGACTCAGGCAGACCATAATGACAGAAGACAGCTTTGACGAAATACACCGCGGTTTCGGCCGCGGTGACAGAATCAGCCACTG
GAATTAGATGAACCATCTTGCTGAATCTGTCCACGAAGACTAAGACACCAGTCCGACCCTGCGCATCGGGTGGGAGCCCGAAGATGAAGTCCATTGACAC
CGAGCGCCACGCTTCGGTGGCCACAGGAAGTGGNGGGGAACGAAGATGCGCCAGGATGCTGGCGTACATCGAGTCATCCTTGTACGAGGCAGCTATCTCT
TTGCGTAGTGACATCTCGGGAGCTACGGTCGTCATATTCAAGCCGGAAGCGATGCACATTGTGCagccatcttcgtcgtcttcgtcctcagtTTTCTGAT
GACCTAGCACCACACGAGGATCGTAATCAGGGCGTCGGGACAATGCATCGGCGAGGATATTGTTCTTGCCGGGCTTATAGTGTACGACAAAGTTGTATTC
GGAGAAGAGCGACAGCCATCGTGCCATGCGTTGTGACAAATGTGGActcttcgtcgctgtgcGCAGCGATGCGTGATCAGTGTACAACGCGAAGGTCTGT
TCTCCAAGCAGATATACTCTGAACTTTATCAGAGCATAGCGCATCGCAAGGAGTTCCTTGTCGTGGACAGGGTAGTTGCGTTCAGCCGATTTCATCTGCC
GTGACTGGTAGTTCACGACCCGTTCACGGCCCTCATCGTCGAATTGCATGAGTGCACAGCCGATGGCAAAGTCGCTGGCGTCGCACATCACGTGGAACGG
CTTCGAGTCGTCTGGAAGCATCAAGATTGGTGCCTCTgccaagctcttcttcacggaGTTGAAGACAGTCTGGTGCTCAGGACGCCACGACCACATGGCG
TCTTTCTtcaacaacgacgacagcggTTGGATCAAATCAGCGTAGTTCTTCGTGTACTTGTGCAGGTAATTAGCCAAGCCCAACCACTGACGTAGTTCAG
TAGGGTTTGTAGGGGTTGGCCAAGAACAAATGGATGACACCTTTTCGGGATCCGCGCGAAC