Description :
From Genome Similarity Track
Location :
Scaffold_3468:555- 2536
Sequence
1981 bases(100 bases per row)
ACGTCACTCTTATGCATAAACATTCACTTCTTCCTCCTAATCCACCCTGTGGATTCGTCTTCTCTTTCTTCCGATGTGACAACTCATATCAGCGATCCTC
CTCCTCCTGACCCACACCCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGATAAGACCAGCTCACATCCCATGGGTCCCCCCCCCTACTCTTCTTCATGA
GACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTAGGTT
CGTCATATCCACGCCAATGCACCAGAAACTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGATCTCATAATGGTGATCTTCTCGACTTCGAACTC
GTCGGCTTCGAGATCCACATTCCAACTGTCTTCCGGTAGGAGAACTTCGTCGAAGTCGACGCGGTCGGATGCATCTACCGAAAGACGGACCTGCGGCCGA
TCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACCACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCCTCACCGCATGTTCTCCAA
TCTTCTCTCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGAGCGTACCCTTCTTTCACTCGATCCAAATCTACTCTTCTTCATGAGACTGC
ATCACGCCGAATCTGTTACGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCGACCCAACTGGGTTCGTCAT
ATCCACGCCAATACACTAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATATCGGTGATCTTCTCGACTTTGAACTCGTCGTC
TTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACCGAAAGACGGATCTGCGGCCGATCCGGG
TATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCATGTAGTATTTCTGGAC
TTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAG
TAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGA
CGTACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATACCATGGTTGTTCGCTGTCGCTGCCCCAT
GATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCTCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCG
TACGATTCGGCAATGGTCTGCGCAGTTCTAGACGCACTAGCTTGGGCTACCCACATATCCGTTAAAACAGGTTCCCCCCAGATCAAACAATTCTTTTTTT
TCCTAGCAAAGCACTGGGTCCAGCCGGGAGATAAAATCCCGGACAATGATTTGGAAAGGGTAAGTCGCTTGGAATTCCCAGGTGACTCCCCTTCGATTGT
GGGCCTGCCCTTGCCTGTCTCACAATCCACACATTCCCCGACATACCGTTGTACGCTCTTAAATAGTCCCCCCCAGTGAAAACATTCCCGGATCCGTTGG
TAGGTCCGACCAATGCCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATC
CATCCCGATCCTCGTTGACTCTCTTCGTAGGAAGGCAATAGAGGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGA