Description :
From Genome Similarity Track
Location :
Scaffold_260:555- 2272
Sequence
1717 bases(100 bases per row)
ATAGGTCTTCTCCCGACCTAAGTGCCCGCCCATGGGCGTATCATGAACCTCATAGAGGATTCGATACTTAAGATTCTCATTATGAGGAACGACTACACGA
GGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGCGAGTATCGATGCAGCCTCGCGCGTAAGCTTAGACAGTTCATTGTCAGAGTAT
TTAAACTCGTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCTCCGCGTATCAAGTCAGGCACTGACGACGTCACTGTCG
TGACATGAGCTAACTTGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCCCGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAA
GAAGAAAAACCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCCGTGCGTAACGACGTATGATCAGTAAAGATCACAAAAGGCTTAGAGCCT
AGCAGGTGTACCCTGAATTTGACTAAAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAGTTATTCTCTGCAGCTTTGAGCTGGCGAGACT
CAAACGCAATCACGCGTTCACGCCCTTCGGCGTCTGCTTGTAGCAAAGCACAACCGATTGCAAAATCGGAGACGTCACAGACGACGCTAAACGGACCATC
CGGGTCCGGTAGCGCAAGGATCAGAGCCTGGAGGAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTGATGCTCGTCGTTCCAGCACCATGGTGCGTCCTTC
TTAAGGAGATCGGATAATGGCCGAGCCATCTCCGCATAGTTCGCGCTGTACTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCTTTTTGGT
TCTTGGGAACCGGTCAGTCCACGATGGCCTTGACTTTGGCAGGATCTGCCCGTAAGCCACGCTTCCCAATGAAGCACCCGAGGAACGGTATCTCCACCGC
GCCAAAGACGCACTTGTTTAAGTTGGCATACAACTTATTAGTGCGTATACACTCGAGCACCGCTCGCAAGTGGTCAATGTTGTTATCCACGTCTGACTTT
CCGTGCTCGGCACGACTATGGCCGAATATATCGTCAAAGTACGTTTGAGCATACGCCCGGTGGGGCCTAAACAGCGGCGTCACAAGACGATTAAACGTTG
CTGGTGCGTTCGACAGCCCCTGGGGGCATCACCAGCCACTCCCAGAGCATACCGCTCGGAGTACTCACCGCTGTCAGCGGAACGTCGCTCGCTCTCATGA
GCAATTGGTAGTACCCATCGACCAAGTCGAGCGCACTGTACAATGTACAGCCTACCATGTTGTTCTGCAGAACATCCTTGCGAGGAATCGGCGTTTGCGC
CGGGATAGTGGCCGCATTTAGCTTGTTAAACGCATGAACAATGCGCCACTTGCCGTTCGGCTTTCTGACACAGAACGTGGGTGTCGAGTGCGGAGACTTA
CTCTCACGAACCATCCCTGCCTCGTGCTTCGCACGGAAGAATGCGTCAATGACGTCACACTGCTCTCTCGTCAAAGGCCATTGCCTTGTTACGCAGTATT
TGGTTCCAGGAACCAGGTCAATCTCATGACACACGCCTCGATCCGGAGGCAGGTTCGTCGGTGGGTCTTTCGAGACAACGTCTCCATACTCTTTCATCAC
CGGGTAGAAGGGATCCG