Description :
From Genome Similarity Track
Location :
contig_32:554908- 557157
Transcript NameFunction/comments
g7393.t1RAW37126.1 hypothetical protein PC110_g6618 [Phytophthora cactorum
g7394.t1ETI36942.1 hypothetical protein F443_17044 [Phytophthora parasitica P1569

Sequence
2249 bases(100 bases per row)
CGGTCGCGACCCCGGCGGCCACGACTGGTACCCCTGCTACGGAGGCCCCGGTGGTTGAGACTGAGGCCCCGGTGACGGAGACCGAAGCCCCCGTGACCCA
GGATGACACTACCCAGCAGACCGACGTCGCCGGTGAGGCCGACACGTCGGTGGCGGGCTCGGGTGATGCCACCCAGGGCTCGGACGCCACGCAGCAGACC
ACTCAGCAGTCGACCATCTCGGGTGCTGCCCAGTCGTCGGCTGGCACTGTCTCGAGCGCGTACTCGTACACAGGCGTGAACTGCGGTGGCCCCGGCTCGT
ACGACCAGGTGACGGACATCGGCTCGTGCACCAAGTCGTCGGTGACGACGACGAGCCCCGTGTCGCCTCTGGACTCTGGAGTCACGCTCGCCTTCCGTGG
CCCCATGACCATCTCGAACATTGCGGTGTTCGACGGCAACAACGGCACGTGGAGCAAGGTGTCGTCGTACGAGAACGGCGGTGCCGCCACCAACATGGTC
TTCCTCAACAACGAGAACGTCGACTACACGGGTGCCGGCTCGCCCGAGGGCTTCTGCGAGGCCAACGGCGCTGGTGTCGCCCAGCAGTCCACGCCGTTCA
CCGGCACGCTGGCGGCGGCCACGAACCCGAAGAGTGGTGCTATCCTCGCTTCGGAGGCCACGGGTGCTGAGGTGCACATCATGACGGAGAACCAGTGCGG
TGTGGACGTCGAGTGCGAGGGCGCCTACGACACGGACGGCACGGCCTTCCAGGGCTGGACCGGAGGCAAGAAGATCTTCGTCACGAAGGTGTCGATGGAG
AACGGCGGATCGCCCGATGTCCCTGCTATTTGGATGCTGCCTGACCAGGTGACCCACTCGGGCCAGTACGGCTGCAACTGCCGTGGCGTCGGCCCTGCCG
GTGGCTGCGGTGAGCTTGACATCGCCGAGTGCTGGAGAAGGACACGAGCTTCGTGGCCACGCACTTCTACTTCTACGACGGAACGTACAACCCGGGTAAC
GACCAGTTCGCCCAGCGCCCGACGTCTGGCCCGGCCACCTACGTGACCATCGTCGACCAGGACTACGGTGTCAAGGTGCTCGCGATCGGCGCGGACGACT
TCGACTTCAGCTGCGGCTCCATTACGGACGACGTTGTGTCGCAGTGGGAGGCCGCCGAGTAAACTCGTTGTTGAGTTCCTCTTTTTGTGTATAGCCTCAA
CAAGCTTTAAGCTGTCACGTTCCCCGATCGCAGGGCGGATTGCAATAGAGTTGTTTGACGTCGGAACATCTCTCTCTTGTATTATGATTGTCTATTTGCT
GTCGCGTGATGGCGGCCATGAAACGTGGACAAACAAACGCTCCTTTTATTGGACCGACGTGAAGTCGATCACGACCTTGGCACTCTGCAACTTGTGCTGC
GAGTACTTCACACCGGCCATGTCCAAGAGCCGGCGAGATGCCACGAACTTCCAACTGCAAGTGAGTCAACAAACCGTTTAGAGATCAAGCCATCATCTTT
GCATCTTCCAGTGAGCACACATACTCGTGATTGTATTTGTCGGAGCAGTACACGACCCGCGAGATGCCACTCTGCATAAACACAACCGAGTTAGACGAAT
ATCTGAAGTAACTGCACACATGACACTTCAGTACCTGGATAATGAGCTTGGCACATTCATTGCAAGGGAATAGCGCCACGTAAATCTGCACGAGCACGCA
ACAGTGAGATTGGGCAGCAACCTACAACCCACATCAAAACCCAAATATTCGTACAGTGCATCCTTTCACGTCAGTGGAGTTCTTGTTCAGGATGGCGTTC
ATTTCTGCATGACAAACATACTGTGCAAAATGAAATTAGCCATGGATCTGGCAGGAAGACGGTGCCCCCACCACTCCTACGTACCGGGTACTTGGTATCC
AGCGGCGAATCGGTCGCGCTCTCACGCGCCCATGGCAACTCGTCGTCGCCACAACCATTTGGAAATCCGTTGTAGCCGATGCCCACAATCTTGCGCTCAG
GGCTCACAATACTAAGGCCCACAGCACCTCGTCAGTCTAACATTCTCTACACCCAAACAGTGCGCAACCTCACCATGCACCCACTTGCGTCGAAGGGTCT
ACCCACCCACAAAAAACAAAACTTCATCAGGACACCTTTTTTCAACTCGCTCAAAAGTACCAACCTTTCGAGCGCATGGCACTAAGGAACGCGACGCTCA
TGAAATAGTCATCCCACGACAAATAGTCGGAACGTTTCTGCACTGGCGC