Description :
From Genome Similarity Track
Location :
contig_22:554729- 558723
Transcript NameFunction/comments
g4816.t1hypothetical protein PHYSODRAFT_516317

Sequence
3994 bases(100 bases per row)
GTTGTTGGTTCCTCGTAACAGCGTGGCCTGTTCCTCGGCTGCATGCATCAGTTTCGCGTAATGATTCCACCCACCTTTTGGTTGGACAAATCCCCACAAC
GCGTTGTCTATCATTCGTTGGTAGATCATAGGCGCGTTTCTTGAGGCCGAATGGCATTCGAAGCCATTCAAAGTGCCCCAGTGCACAGACAAATGCTGAG
ATCTTTCGCGCTCGATGAGTCATCATTATCGCCCAGAATCCGCTGGCCGCATCGAGCGAGCAGAACCATAGGTAGCTCTCTAGACCCGTCAGCAGATCAT
CGACGAGTGGCATCGCGTATTCCAAGATCGTTGTGACGGCGTTCACCATCTTGTAATCAATGCACAGCCGAATATCCACGCCGTTCTTTTTCAGCACTAT
CACAATTGGCGACGCCCACGGGCTATCCGAGAACGACACCAATCCAGCTTTGAGCAGCCCTTTCAGAAGCTCATATAGCTTTGGCATGTGTCGAAGCGCC
ACTCGTCGGGCACGCTGTTTGATAGGAGCGTGCCCCTTGACATCAATATCGCAAACCACTCCATAAGCTGGTGGAGGAAGCGCGTTACCACTCGAAATCA
TGATTTGCTCGTGTTTCTTGAGCACATTGATTAGTCGCTTCTGTTGCCCACCCTTGAACTCGACGTTTTGTACATTTGGCGCCGAATAGTCCAGTATCGT
GACCGAGGTCTCGGTCAGGTCCGGAAGGAAGGCAAGTTCTTGCGCATAGTCTTCAAGTTCAATGTGGTTGGCTTGGTGTTCAGCCGAGTCCTTGCTTCAT
CGACGTTCATGGTTTCATGTCCTTCGGTGTTTAGAACCCTCATTACCGCCATGAATGTCTTCTCGAGCACCGTCGCCGGGTTCTTATCTATTTTGTTCCC
CTTGGGCGGCGGTTCCTCTTTATTGACTTCGCCAACTGCGGATTCTCTGGTGTTGAACGATGTCTTGGTGGTCACCCTGGTGGTACGCTAACCGTGATCT
TGGCAGACGGTGCGATCGGTATAGATTCTGGATCATTGCCCACTGGCAAGCCATCAGTTTCGTTGGCCGATATCTCGTCGTCGCGTTGTTGCAGGAGTCG
TTCCCAGCGCTGGGCGCACGTGAGATGCTCGCCTTCATCACTGAAATAGTCAGGTGGCCGGCTTCGCACTCCTCGGGGTGGTGTATAATCGACTTTCTCC
ACTGCCGAAGGTTGTTTGGCGAGCCATTCTTGGTACAACGTGGCTTCTTTCTCGTACAGAGTTTGATCCCGTGATTCAGCATAAGCAATCACTTGCCATT
CCTGGTACTTCCTTGAATCGAGTCGAACGTAGCCTGCTTCGACCGGCAAGTCACCATGTGGTACCCACATCACAAAGGGCAAGTGAATCGGACAAAACAC
CAAGTTATCGGTGATATTCGTCAATCGAACTCGCTCCGGGTGACCACGTCGAAACCTCGTCACAGTCGGCACCAAGCAGTCCGTTCGTCGGATCCATACA
GCATGTGTATCCAGCGTTGGTTTCCGTTTTTGTAGCCGGAATTCTCCCCATTCGTGTCCAGGTATCTGTAAAAGCTCGGTAGGACCACCGAAGACATGCT
TACGCCCGGGATTATCGTCATCCATCATGTTTTGCGTCTTGATCAATGGGATCCTGACCTCGTCCGTTGAGTGGCGTGAAATAGGTCGAGGCGAATTCCG
GCTGGGATCATAAAATCGGTGCCAAGCACCACATCAACTCCAGCACTGTGATCCATAATCCACACCTCGAACTCGTACACGCGCTCCCAGCCGAGGGTCA
CCTTGACGAGTGCTCGGCGTGTGGTCGCTATCTTTCCTTTCTGTATTCCTTGTATTTCCAGCCGTCGACCGTTGTCTGGATCGGTCCTCATCTTCAGCTT
CTTTGCCATTGTAATGACACTCACATTTGCCCCAGTGTCGAGCAGTATCCGCATTCGTGTGTCGTTTACCCTCCCATAACCAGACTCCTCACTCTTCGGT
CGAACTTCTGCGACGACCACCACCCCAGTCGTTCTCCAGGCAGCAATCTCACCGTCTTGGCGAGTCCTCGAGGTAACTTTTCCTCAGCCACCGCACTCGA
ACCCAGGCTTCGCATTCACTCGACCCGCTTTCTTCATCTTCACTCACATCGCCTCCACCGAGGTTTAAAACTCTCTCCTTTTCATTGTCAGTCCATTTCA
CTCCATCTCCGTCGTCATTATTCGGCCATTCGCACTTGCCCACGTACGTAGATATCTGCGTCGAGCGCGGGTTCGGCTAACTGTGGCAGCCCGTTAGGGA
CCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGCCCAAATACGAGGGTCTGGAGCTCGGGCGAGAGGTTTCTTGTCAACCTTGTTCTTGACGAG
GTTTGCGAGTTCTTGGAAAGCTTCGCACTTGCCTGCATCATGCACTTGTTTGCATAGTTTGCAGCGCTTGTAACAATAGTGCGCAGAGTGAGTGAGACCA
CCGCAGGCAGCGCACGGGCCATACTGACGGCCGCTGTCGCGTCGGTCTCGACCACGAAAACGGTCACCGCGGTCTCCGCCGCGCTCAGGTCGGTCACCCC
TTGGTGGGCGATTGTCAGTCCGGCCATAGGTGCCCTCAGCAGCAGTTCGTCGTTCGCCTTCATTAGCCGCAGCGAGGTGTCGTTCATCATCTTCCGAAAC
GTAGCCATCGCTTCTTTCGTCATCGTAGTATTCCGACTCAGAAAAGTGTTCGTCATCGCTGTACTCATCTCGACGTGAACCGGAATGGTCGGTGTAGTCT
GCATTCGGATCCCGGAGTTGCATCTCAGCTATGAGTTCTGTCAACGTGGCTTCGGCCAACATCATTCGTGGCAGATTGCGATAGTCGTCGCGTCGACGCT
CGTTATCGCGGTCACGTCTGTCCCGGCGGTACCCATCCCGAGGATCGTCAGTGCGCCGGTCGTCACGTCGTCGAGAGTTGTCGCGGCCTCGTGGCAGGTC
GCGACCCCGATGTGTGGACTGTGATGTCTCCTTAGAGGAGCCACGATCTTCCATCTTCAAGATCTCGTTGATCATCCGTTCCAAGTCATGGATGTCGCTC
ACCTGCAAGTGTCCAAGACGGTTTTGGAGGCTCTTGTCTCCACACGTCTTTAAGAATCGTCGAACGTGGTCACGCGCTTCCCGTCCGCCGTTCGCAAATC
GAACATCGGCGTTCCTTGCATAACCGTTGAGTCGGTTCAAGTAATCACAGATGTGTTCTTTGTCCTTCCGTTCCGCTGAATAGTACCGAGTCTTGGCCGA
CTCGTTAAACTGCGAGCAATAGTACTCGATGAACTCTGCATTGAGCAGCTGCCAGTCGCGCCGAGTCCTCCTTGGGAGTTGACGGTACCAATGAAGGGCT
CCGTCCCGGAGGCTCAGTTCAAAAGCCATGCACCACTCATTAGGCGGGTATGCGTCCCTTTCATCTCATAGACGAAGGCTCGTAGCCACTGCATTGAATT
TTCTTGCTTGTCGCGGAGTCCGAGGTACGGCTTGATCTGGCGAGGGGTCGATGCGTTGCAATCTCGAGTTTCGGTGTACATTCAAACTTTCCATATGCTT
GCTTCACGCATCTGACGCGCAAATTCAGCAGCTAAGTTGTCACCATCCCCATTAAAATCCAGCAGGTCACGTCCGTCGTCCGATGAGTCATCGTTGCCGG
ACAGTTTCCACCCAGGACGTCGTCCGATCCTCGTTTCGAGTTCCGCGCTGGGTTTAAGTTATCGGTATCACGCGCTAGCCGCGCAGATCGATTAGTCGAA
CGAGGTGTCACCATGTGCGAGTCTTGGAAGTACGGGGAACGCTCGGCCGACGTGGCGAATGCTCCACCCAGCTGTTGTTCACTTGCACGGTGCCTCCATG
CCGCTTGGGTGTTTGCGGTAATGGTATCATCGATGGGTCGACAGTTTCCCCAGCTTTGCGCGCCACTGGTTGCCTTCCGGTACGATCGGTAGCC