Description :
From Genome Similarity Track
Location :
Scaffold_17:554697- 556820
Transcript NameFunction/comments
Physo_131820hypothetical protein

Sequence
2123 bases(100 bases per row)
CGAGCTGTGCGGCGGTTGCGGCCAAGTTCTGGAAGGAGAAGCCGTTGGCGCGCTCAACCAGTACTTCCACTACGAGGTATGCGCGTGTGAACGGGAAGCA
TGGTGTGTGCAGTGTCTAACGAAAACTCGTGTATGCTTTGCTTGTCTACAACAGTGCTTCAAATGCAGCCACTGCACCCGTGTCATTGCGGAAGATGATG
GTTACGCGGAGAAAGACAACCAGGTATGGTGTACGCTGCGGTTTTCCATTACTAACCTTGTCTGATTAACTGAATCCTTTATCGTCTGGCGTTAGGCATT
TCACCAAGGATGTTACCAGGCTCGATTCGGCAAGAAATGCCATCGATGCGACAAGGTTCTTAAAGGAAAAGTGGTCAAGGCCCTCGACCACCTATACCAC
CCGGACTGCTTCGTTTGCTATCAGTGCAGCTCTTCCCTTCAGGGTACGTCTCAAAATTGCACCAGATTCAATATGCGCTTCCTTATACTAACACACGAGT
ATTTGCGCTCGTCCAGCAGAGAGTTTCTTCGAACACGACGGCCAGGCTGTTTGCGCGAAGTGCAAACACGAAGCAATCGCGGTGGATGAACCCGGCTTCC
CGTGAGTAAAGCACATAGCTTTACTAGTAGAAGCTGCATATACTGACTGGTTTACACATTGCTGTTCCACAGAGAGAACATGACTCCGGTGTCCAAGGGC
ATTGCTGGCTATCGGTTCGACGCCCAGGATGACACACAATTGACTATTTATCCGGGCGACGAAGTCGCTATTCTTCAGAAGGTACGTCAACTTCAAAGAA
AACCTTATGCCTTGAGTTTGGTTACTAACTGCTTTTGCGCTACAGGATGATGATGGCTGGTGGCTGGTGGAATTGAGGAACCAGCGTGGTTACGTACCAG
GCTCGTATTTGATTGAGCGGCCCATCGAAGAACCGAAGCCGCAGCCGAAGAAGAAAATGAGTGCGTTCAAGAGTAAGCCCAAGCGCACGCCGGGACTTTG
CAGCTCGTGCTCGACGCAAAATCCGGCGGAGGCGCGCTTCTGCCGAAGCTGCGGCAACAATCTGATGGCCTAACTGCAGTGCGGGGATATAACGAGAAAG
GTTCAAGAGGCAGTTTGTTTAGAGGAAAAAAAATACGCGGACAGGGGAGACACAAACTGACCCGGCCTTATGAGCCGTGCAACGCGGTGGTGGCATTAGA
ACTTGGTGTCTTGCTCTTTGCAGCGCGAGTGTACAAGAAGAAATTGTCTCCCCGTCCCCTGTTCTCATCAATGTAGGTGTTTTGCGCTAAGGAAGTTCAA
CTGGCACTTCAGCGTCCCAATTCTGCGGGGTTTTGTCGTACCACATGCAGCCAACACCCTCTTGTTTGTTGAGCCCTCCTCCCCACTAGAGCATTTTCCT
TCAAGTTAGCAGACGAGTTGGTAATCCATGTGGAGCAGAGTGCTGACCCAACCGACTGCAGCTCTGCCTGCTACCGTGCTTGCAGGTAGTTCGCGTGGAC
TGCGGTCTCGTCGGATCATCCACGTGTGGGATCGGGTGCAGCCGTCGTTCTGGTATCCCATGGCGTCGTTGGAGCAGTCGCTCATGGACATGGAGGTGAT
GACTCGCCGGGTGTTCTCGCCTCGCTTCCCGCCGTTCGCAGCGTTCTCGCCCAGCACGATGCCGGAGCTGCACTGCGACGACGACGAGTTCTTCAAGGAC
CTGCCTATCGGGAAGCCTCAAGATGGGACGAAGCATGGATTGGAGACTGCAACGGCCTCAGATCTAGCTGGCGACGCGCCTGAGAAGGCGGGGACAGAAG
CTGCGCTCGACAAGAAGGAGCCCTCGGCCGGCGCGGAAGGCACAGTGCCGCACCCTTCCTACACGTCGTACTCGTACAGCTGCTCGACGGTGCTGGACCA
CGGAGGCCACCGCATCGGCACTGTTCGTCGCCGCTACGAGGACTCGACGGGGCGCCTGAAGGCGACGCACGAGCGCGAGATCGACGGCAAGAAGCTCAAG
CAGATGTGGCTGCGGTCCAACACGCAGGACGAGGGCGGCCACGAGACGATCTGCTCGAGCGGCAGCCCCGAGGAGTTCGAGAGGGAGTGGCTGGAGACGC
CCTTCGGCCGCGCGGAGGACGAG