Description :
From Genome Similarity Track
Location :
Scaffold_65:55453- 58243
Transcript NameFunction/comments
Physo_159094PsAvh137
Physo_138595Avh_137

Sequence
2790 bases(100 bases per row)
GAAAAAAAAGAAGCGTCTCTATATGATTCTGTAGTCGATGAGTACAGGTACGTGCATTATACTAGTCGTTGAAGCTCAGTACGTGTTCTCGCGGTCGCGA
AAGAATAAAGACCGATGCATTTATCGCAAAACGACAGGAAAACAAAGAAACGATCACGTAAGGTTAATCGATTAGAGCACGTAAGTTTAATCGATTAGAG
CCCCTGATTTAGGGGCTCTGAACGTCGTACTGCAACAAGCTAAGCTTAGAGCGAAAGTTCAGGTGGTCAGTCATCTGGCGCCGCCGCTAAAGTAAGGCGG
TAGTGAAACATCTTTTACTAAGCTAGCATGAAAACGTACGCGTTAGTTCGCTTAAGGTTTCGGCCTAACAAGACTTCGATCCATATCGCTCCTCACTCAC
GGGTAAATGTATCCCTCAAGCTCCTTCTTCCTACGCTCACGACGCTTCTTAGCGGTGTAGTACGAGTAGTAACCGAGGTAGAACCGCTGCAGATCACTCG
CCTGCTTCGGCGATCCAATCGACAAACCGATCGCCTTGGCGACCTGCGTGGGGGTCATTTTCGCCTTGTAGAAGAGCTTGTAGTTGGTTTTGGCCGCACC
CGCGCGCTCCGTCATGCTCTCCAGCTCCGCCATCGCCTTGTCCTCGTCGTTCGTGTCGAGCTCTGCGTCGCGTTTCCTCAGAAATCGTCCGTTGTTACCA
TCATTGAGGGCGGCGGCGTCGGCTGAAGTCAACTTGGAGCTCTTGGGATCGGCCACGGCAGCGTCGCAGCAGGCGAAGAGGGCGAGCGCCGCAACGGCGG
CGACGTGAAGCAGACGCATTATTGCAGATTCTGGGGGCCTCTGTCGACGCTGTGGCAACAAAGGGCAAATTGCGAACTGATGACATGCAATTGGTTCATG
AGGCTCATGAATCATGATGAGCCAACGAACAGCACAGCTCGACAGCAGCAAGGCGTCAGATGGTCGATTTGCTTTATCTTCGGGATCGAAAATGTCCGGA
TGTATTGCAGCCGTCGCTCGATCAAGCCCAGCGCTGAATACATACTGGGGCGGCATTGACATGTGAGGTCAGCATCCTTATGGAGGCCTTAGTTGGAACG
GCGTTACGGCTACATGATTACGACAAGACGACAGCTCTTACGGCACCATAGCAAGGGTTTTTCCACATAGCAAACACCACACCAAGCAACGTAGAGGTTG
TATGGTAGAATATCGTGTCCGTTCGGACATCTAGAATTTCGCATTACAATAGTACACTAGCGCTTGGCCTATCAGAAGACTTTCTCATACTTTGTGAGCC
AATCGGCGTGACTCAAATCTCATGCTGTGCCGTAAGTAACAAATCGGGCAATTCGGACATATTTAGTCCGAACATCTGAAAAATATTTGATATTTCTTTA
GTCAAAGCCAGTAAGTCAAATATTCTGAAAATATCGTCAATATTCGGGCACGTATTAATTTTAAGGGCGCCAGACAGACGAGGCAGCATAACCACTCAAG
AAACGACTCATGTCGACGAAAGCGCTCATACCTGGGAACTCCCAGCGGGCTCGCTCGACGGCTCTCAACGCCTTCTAGCGCTTCGCGGTCGCCGAGGGCT
TCACCGTGAACGCCATCTATGAGTTTGTAGGTGGGGATTCAACTGGCGATACTCTCTCCATTGTTCTCGACAAATTTGCAGTGTATTTAGCATTTAAAGA
AAGCTCGAAGGGCTCGCTGCTATCCAAGAACTCGGTCGCCAGCTACTTTGGCAACGTCAAGAACCACCTACTCGAACTGTTTCCAGCTTTAAGTGCTGTA
TCGGGTCGTCGGCTGCAAAAGATTGCGTCAATCCTCGACAAGTACTGCTCCAAGCGAGGCACAGACTATACGCACCAGGCCCCACCGTGCACGAAAAGCG
ACCTGCGCTCGCTCAGCTTAGCGATATTGAAGGGGGCTGTATCTGTGCAGGACTACCAGGATGCAGCCCTTCTCAACATTCTTTGGTTTTTGCTGGGTCG
GCCTTCAGACACTATGTGTCTCGTGAAAAACCAGGTCGCTGTTTACCCTGGTAAGTACTTGTCTTTTTATTTTCCCTAATTTGGTGTATTTTTAATCGTG
GTACACAGGTGGGTGTCTATTTATCACCTTTAAGCGCATGAAGTCTGCCTCGTATCAAGGAGCGTCGATTTTTCACGACCCAAACGATTTTTCGTCTTGC
CCAATTCACGCACTAGCTTTGGCTACAATTATGCAGTTGACTCCAAGCGAGTTTCTCATGGATCAACTTCCTCGGGATACACAAGAGCTCCTGCCGACTG
AAATTGGCGAAACGCCGCTCCGCGAACTACTTGATGTGCGTACCAGGTCCCCAGCAACCTCCAACTCTGAGTCGCCGACCCCAAAAGGACCTGCGAAAAA
AGCGACAGTCCCCGGAATTCACGCGTATGTTAATCGCGTACTGCAGAAGTGGAGTGGTGTCTGCCAAACCGAAGGTACTAACCTGACGCCAGGGCTATCA
TCGCATTCATTTCGGCGTGGAGCTGCTCAAAACGCGAATAGTGACAGCAAAATCAGCACACCTTGGATTCTAGACCATGGAGGCTGGAGCATGAGTGCTG
TGAGCAAAGCGTTCAATTATATTGTTGGCACGACCCAGGAAGATCAAACCGTCGGCAAGTCGTTAGCTGGATGGGATTTAAAAGCTAGTCCGCCGCTTCC
TACACTGGACGACTTCGATCCTCTGGTTCTGCATCGAATTCGCCTACTTCAAGACCGGCTTTTCTCGGCTGCGAAGGGGTTCACGGAGAG