Description :
From Genome Similarity Track
Location :
Scaffold_1217:5545- 8496
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1217-snap-gene-0.5ATP-binding Cassette (ABC) superfamily

Sequence
2951 bases(100 bases per row)
AATACTGCCGCACTCCAATATTTCTATATCGCCATCGCGATGTTCGTGACTGAGTATACGTCGTATGTGCTGTTTTCGCTCACAGCCGAGCGCCAGATGA
AAGTGCTGCGAGAGAAGGCTCTGCGCCACATGCTGCACCTCGACATTGGCTGGTATGATAGCCACGACGCGATGCANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCGGCGATTCCTGCAAGTACACGTGCCAATTCATCGCC
GGGTACGTCATCGGGTTCAGTAAATCGTGGGACATCAGTCTGATCATGCTCTGCGCGATGCCGTTCATGGTGGCGCCGTTAGCGTATCTGCTGATCATGG
TTCGGAAACGCTCCGAGCACTCGCAGCAGATCTACGCCGAGGCCGGATCGGTCGCCGAAGAAACGCTGGGCTCAATCCGCACCGTCGCGTCGCTGAATNN
NNNNNNNNNNNNAGCCGGAGCGATCGCCAAGTACAACGAGAAGTCCTTTGTCGTGGAGCAAGACAACATCAAGATCGCCAAGTCGTACTCGACCGTGCAT
GGCTTGCTGTTTGCAGGTATGTGGGTCATGTTTTCGGCGGGTCTATGGTACNNNNNNNNNNNNNNGCGGCTCGAAAGTTGTTCATCTCAAGAAAACGCCG
GGTGAGGTGTTCCAGGCGTTTATTGGGATCTGGCTTGGTACCTACTCGATGGCGCTGATCTCACCGAGTATCACTGCCGTTGTCAGCGGGAAGGGTGCAG
CGGGAGCGCTATACAAGATCCTCGACACGCCGTCAGCGATTGACGCCTCAAGCGAGGATGGATTCATCCCAAAATCGTGCGCTGGTCGTATCCAAGCTAT
CAATGTCAACTTTTCCTACCCAAGTCGCCCCGATGCCCAGATCTTGATAAACTACAACGTGACCATCGAAAGTGGACAAACCGTGGCTTTCGTGGGGCCA
AGTGGTGGTGGCAAAAGCACGCTGATCGCGTTGTTGGAACGATTCTACAACCCGACGAATGGTGTCATCCTACTGGATGGTCGTGATATCAGCTCGCTGA
ATGTCAAGTGGCTTCGTTCCCAGATCGGGTTGGTGTCACAAGAACCAGTGCTGTTTGCCACTACCATTTACGAGAATATCGCTGCTGGACGAGGCAATGT
CACTCGTGACCAGGTCATTGAGGCCGCCAAGTTGGCGAATGCGCACACTTTCATCATGTCTTTGCCAGAAAACTACGACACCCTAGTTGGCGAGAAGGGC
GTCTCACTGTCGGGAGGTCAGAAGCAGCGTGTTGCCATTGCCCGTGCCATTGTTCGCGAACCCAAGATCTTGGTGCTAGATGAAGCCACGAGCGCCTTGG
ATGCGGAAAGCGAGCGTGTCGTCCAAGCAGCTCTCAACGATCTCATGGACAAGACCCAGATGACTACGTTGGTGATCGCGCATCGTTTGAGTACTGTGCG
CCGCACAGACAAGATTGTAGTGTTATCGGATGGCACCGTGGTCGAAGAAGGACCCCATGATGCTCTGCTTCAGATCGAGAACGGAATTTACCGCAACTTG
TACACTCTCCAAGAAGAGAAGGCTCACGAAGAAGCCGAAGCTGCAGCAGCGGAAATCAAGAGTTCGAGTCTCGAGGTTGTCGATGTGGCCAGGGATCGAA
AAGCGAGTGTTCAATCCGTGCGAACTGATGGACACGGCGAAGTCAAACCTACGAGCGACGACGAGAGCGAGGATTCCACTAAGAAACCCCAATTTTCCAT
GTTTGATACGCTGGCGTTCAGCAAACCGGAGCGGAAATACATGATTACTGGGCTTATCGCTGCTGCTTTCAATGGTTGCGGGTACCCAATGGCTGGTGTG
CTCATGAGTGAAATGCTCGCGGTCATGACGGAGAAATACGCGATCTACGAGGTGTTCCACATCCAGTCATACTTGAGCGATCTCTCGCACGACGTCACAT
TCTACGGGCTGTGCTACATCGGAGGCGGCATCTTGTCGTTTTTCTTCACTGCGATCCAGACGTACTGCTTCAAGTACATGGCCGAGAAACTGATTTACCG
CCTGCGTGATATCCACTTTACAGCCCTTTGTCGCCAGAATATCGCATTCTTTGACGAAAAGGAGAACAGCACTGGTGCACTGACAGCAGATCTCTCGGCA
CACACCATCCAAGTCGCGCTTCTCTCAGGAGAGTCCCAGGGCCAAGCAGCTCAGGCGTTTTTCACCTTTGTGGCTGCGATCGTGATCTCATTCACAACGG
GGAGCTGGCAGCTCACGTTTATCATGCTCGGAATGTTCCCGCTCTTGATGTTGGGCCAATACCTCCAGGCCGGTGAACTCTTCCACGCAAATGATCTACC
TGCCGATCTGGCTCAAGTTGGTGCACGTGCGTCCGAGGCACTCAGTAATATTCGCACGGTGGCGTCCCTTGGTCTGGAGGGCTCTGTCTTGGACAAATTT
GCGATTTCTCTGAAGATTCCTATGAAACGCGAGCGACGCAAGTCCCACACAAGTGGAATGTCGCTGGGTTTTGCATCGTTTGTCTTGTTTGCGACGTACT
CGCTCGTGTTTTGGTATGGCGGGTACCTCGTTGACCACGGCAAAATTACGTTCAAGCAGTTGTCGCGCACGTTGTTGACGATCATGATGTCAAACGTTGG
AATCGGCCTCGCCGTCTCCTTTTTCAACGAGACCCAGAACGCGACGAAAGCTGGCGCTGCTCTGGTGGGTATTCGCGACAGAGAGCTGCCGATTGACTCG
TTTGGAGAAGGAGGGCTCAAGCCATCGAAGGTGGTAGGAAAGCTCGAGTTCAAGAACGTTGCATTCCGGTATCCGACTCGTCCAGATGTTGTAGTTCTCA
AGAACTACAATTTGACTATCGAGCCCGGTCAAACGGTGGCGTTCTGCGGCC