Description :
From Genome Similarity Track
Location :
scaffold_37:5544- 7518
Sequence
1974 bases(100 bases per row)
AAATTAATTGCAAGCGAATCTTGCAAAGTGTATTTTCGGTGCTAACGAAGCACCGGTCCTGGTTGTTATGTTGGTCGAAATGATGTTCTTGCAGACCCCG
AGAAGATCAAAGCAATTTTAGGGTAGCCAACGCCACAGAATAAAGAAAATTGAGGAAATGGATAAGTTTGTCCAATTATCTACATCGTTTCTCGCGTAAC
CACGCGGAAAGGTAAGTCCACTATTAAAGTTGCTGTATAGGGACATACCGTGGGAGTGGACATccacttgtgaagaagcattCACTCATATCAAGGACAG
CTTGATGGAAGCAACATTACTTGCTTTATTAGATGACACGAAGTTGTATAGCGTGgtatgtgacgcttctgagCTTGCAATCGGTTGTGTATTATTGCGA
AAGAACTCAGAAGGAAATGATCGTGTCGTGTCGCttcaatcgcgacagctgaagccaGCAGAAAAATTACCCTGTccacgacaaagagcttctgGTAATG
AAATATGCTCTTGGGTTCAATTCCGTTTATCGTCTACACGGATCACCCAGACTTGCGTTATGCAGTTCAAACGCCTCACTTGTCACAGTTGGTAGTCTTT
CTTCGCCGAATATAACTTTACGGTCGCATACGAGCCAGGAAGACAGAACGTGCTGACAAGCGCATTGTCCCGTCGTGCTAGCCCATACCAGCTATATCGA
AAATGATGTATTCGATACGAAGCTTCGAACGTATGTTGAGGATAAACAATCCGATCATCAGAGCACTGTCATCGAATGATATGAAATTCCATGATAAGCT
TTCTGGTCGCTTGAAATCAAGGTTGCATCGTTATGCACGAAAGGATGGTCTCTTTCACTATGAAGTTGCGCATGAAAACGAGCCATGGTTTGCGGTATCC
CACAACGATAATTTGAAGTACAAAACAGTGTACGAGGCGCATGATACGCTGGCTGGTCACTTCGGCCGTAAGAAGACCAACCAGTCTCTCAGTGTCCAAT
TTTGGTGGTCacacatgtacaagtgggtggcgcgatacgtgaagacatgTGATGTCAATCAGCGTGTGAAGAGCGCACAACACACCCTAGCGCCACTGCG
AAGTCTTCCTGTTCCAACTGACTGTTGGAAGGCAGTCGGTCTCGACTTATCGTCGGCTTCTCGCTGATGTCCACAAtgacagactcagcaagatggttcg
caTCGCGCCTTGTAGCGATTCCATCGATGCCGGAGGTTTGACTTAACTGTTCATTAAACACGTTTTTGCAATCACGGGCTACCGAACGCCATCGTCTCTC
ATCGTGATACTTGATTCACGACTATAGAAAAGAATTATTCCGAATTCTTGGCACTCGCTTGGATATGCTCACGGCGGTACACACGGAGACCGATGGGCAA
ATAGAACTTGCCAACCGAGTGGTCGATGATGTGTTGAGGAGCTTCTGTACGGAAAATCTCGCAGTTGTTACCATTGGTTGAGTTTGCTATGAACAATTTG
GTTCATTCATCCGCTATATTCACGCCATTTTCTATGAATGGCTTGCGATACCCGCAAGTACCtctttgtgcgatgggtAGTGGCTTTCATGTAAGTGGGG
GAGGAGTTCGGCAAATCGTTGCCTCTCAAATTGCTACAATCAATGGTGCGAATATGAAGCGCAAGTACAAGAACGCCCTGAACTTattcatcatgagtcg
tgtgaatgtgatcacacgggTGCGAGACGCAATAGAAAATGCGcaaaggaatatgcagatataCGTGGTCGTAAAGGCGTTATCGCTGGGGATTATGTAC
TACTCAGTAATAAGAACTTATGAGACGGTGCGATCTCAAGCTTGGGAAGCTCGATGCTATTACCTCGTTTCGTCGGTCCATTCCTAGCCGTGTAATGCCA
TGGGAATGCTTACACTATCGATCAGCCAAACTGACTAAGGATTCATTCAATGCATTCGGTAGGGCACCTCAAGC