Description :
From Genome Similarity Track
Location :
contig_7:55432- 56984
Transcript NameFunction/comments
g2320.t1RAW33326.1 hypothetical protein PC110_g10334 [Phytophthora cactorum
g2321.t1hypothetical protein

Sequence
1552 bases(100 bases per row)
CTGTCCACGCAGCTTCGGCGGCACGCCGGCTTTTAGCAGGGCGTCGAACTGACGCGCATGCAGCATGAGCTCCGCCGCCGTCGCGAACGTGGACAGGGTC
ATCTTGACCGTCTTCGGCGGTGTCTTCTCCTTCTGTTGCTGCTCCACGAAGCGCTTCTGGTTCTCCTTCCACTTCTGACACACGCGCTCCTGCGCCCAAT
CACGCGCCGCGAAGCGCTCGCTCCATTTGCGCAGGCGGAACTTGTACAGATCCTCGGCTGTGTCCAGCTCGACCGGCGTCTGCTGCACGAGACACTGTAG
CACTTGGCGCTCGCAGCGACAGGCCAGCGCCAGACGCGCGTCGGCCGCATCCGCATCCGCCTCCTGTACGACCAGTGCCGCCGTGGTCAGGCGGAAGCGG
CGCGTGGGGCGGAAGCACGCCAGTTGGCACCCGTGCACACGCGGCGTCGAGGCGTCGGTGTGCGCCATCCTCGTCTCGGTTTTATTGTGGGACGTTCTGA
TACCGGAAGAAGCCCTGCGAAAACGAATGCCAACTGCTCGTGGATTGGATGAAAAGCGACGACGAACCGTCGCAGGAACTGTACCGGAAAACCGGTACAT
CCAGGAGTGATGGTTGTGTTCTTCAAAACGGGATCGCGAGCCATACCGACTTGAGCATGTTGCGGCTATCAACGCTGGCTGCGCGCGCTTCCAAGCCGCT
CTCGCGCTCCCTGCACGCCTCCTCGCCCTCCGCCTTCCTCGTGCGCTCGCTGGACGATGTGCGCAAGAGCCACCGCGTCGTCACCAGCGACGACGGCGCC
CTCGAGACGCGGTACGTACGCCCCCTCTTTTTTCTTGCACCATAAACTATTATTTTCTTATCTATATGACGTAATTGCATGCCCACGTTGAAGTCGCTAC
CTGGTGCGAAATGACGAATGCGGCTTCTCGGTGCAGCAGGAGGTGCTGAAGAAGGGCATCCCTGTGCGTCTCGAGTTCCAGAACCACGTGTACGCGCTGC
TGGTCACGCACGGTAGCGGCCGCGTGCGGCTACTTGACGTGGGCGAGGGCCAGGGCCAGTACCAGGCCGTGCAGGAAGGCTCGCTCGTGGCGCTCAACGC
CGCCGAAGCCGTGGAGATGGAGGCCGAATCGGACGAGCTGCACGCCGTGAGCGTCATGAACCCGCCGCTCTTTGGCGTCGAGAAGAGGAACCCGACGACG
GGCGTGTTCCCAGCTGTGGACGCGGACGGAGAGGAGCTCGAGAGCTTTGGCCTGGCCGAGGCGGAGCGCCTGTTCTCCGCCCCCGAGTCACTCCAGGGCG
GCAGCGCCCCCATGAAGGACGACCCGCTGTTCTAAGGAAATAGCAGAAAAAATGACGTTGACTCGACACTTATGAGGACAATACAGGTGAAAATGCTGCC
AGATGCAAGTACCAGGGTCCTGCTTGGTGCGATACGTTGAATTAGGCTTTGATTTTTGCTTTGTTGTGGTGTCTTCAGAGCTGTGAAGGTTTTGAGAGAG
ACTGTCGACGTTGTGCTGTTTGAAAGGCAGCGGTTTCGAGGCTCGCGAGAGC