Description :
From Genome Similarity Track
Location :
Scaffold_32:554127- 559773
Sequence
5646 bases(100 bases per row)
ACTTGTACGCTTCCTTATCGTTACGTGTAAGCTAGTAACGGACACTCTAGGCCCGTTACACCTGATAGTACTTTGTAGGCCTCCCCATGACCAAGCTCAC
AATGAGCCAAGGCCAGACGTCTGAAGCTTCAGGGTCAACCCTGGAGCATGCTGCTTTCCCTCATCTCTCTCGTGTCGAGTGGGAAGCCTTTCACCGCCTT
GCGACGGTGTCCGGTGAGGCTGTTGTCGCGTCGCTGCTGAGCTCAGCGACTCCCGATCAACAACGTCAAGCAGCTCAAGAGCTCATGGAACGCGAGCTCG
CCGACGCGAATCGGCGAGCGACAACTCCCTCGCGTTCCTCGAAGAATGACATCGTCAAGTTGGAGACGTCAACCTACTCCGGTGAATGAGCGAATCGCCT
TCCGTTGAATCGCTGGTTTCGCGAAATCGACATCTCTATCGCCTCGAGGATGATCGAGGCGCAAGGAGCGAAAGTTAACTTCTTACTTTTACGACTGGCC
GGGAAAGCCAAGGAGTGGGCACTCGGCAAACTGGTCGTCAACAACGATGCGTTCTCCACCCTGGCGGCCCTCCAGAGTGATCTTCGTCTCGCCTTCGAGC
CTCCACAAGACGAGTCCCGAGTGCGCGCAGAGTTCTTCGCTCTGCGACAAGGCAATATGACCATGCGCGACTACGTCCAGAAGACACACCACCTCGCGTC
CTACATCGTCACCAATCCGATTGACATGGCATCTCAAGTCCACGTCTTCGTGTTCGGCATGGATGAAGGCATGACGCTATACTGTCTGACTCGAGCGGAA
CCCTCCTCTCTCGAGGAGGCATTTGCTCTCGCACTTCGTGAAGACTACGTGGTGGTGGCGTCGTACGCGCGGGCAATATCCGCGGAAGCTCAAGAGTCAG
TTCCGGAGCCGATGGCGATCGACGCGATTGACGCGTCGAACAACCGCTGTCGCGCAGTTCCTCGTGCGAATGGTGATCGTCCCAGTCGTTCCCTCACTTG
CTTCCGCTGTCGGAAGGTTGGACATCGCGCGGCTGAGTGCCGCGCGCCCGCGCCAGTGCTCGCGCATACTGTCGATGCCTCTCCTACCGATCAGCCAAAA
ACCGGTCAGGGCCAGTAGGTGCGGGGCGTCCTACTGGCTGGAATGGAGGTCCGGGTCCCCTGGTGACAACCCAACCCTCTAGCCCTCGTGTGCTACACGC
ACATTTCAATGCCACCACTGCGTCGGGCGACTCAAAACTGATCATCATCAGCATCCATGTCGCCGGCGCCCGACGTCCACTACGCGCGCTTGTGGACTCA
GGAGCGACAAACAACTTCTTCCGTGAGTGGTGTTTGTCGACGCTACCCAGCGAAATCGCTGTCCGCAACGGTCGCGGACAGGTTGTAGTCAAGCTTGCTG
ACGGAAAGCCGCGCCACGTCGCGCGGCGCGAGATTACGTTGCCGTACACGCTCGACGGCTTTCGCAGCAATGACGACTTCCTCGTGATGGAGACGAACTA
CGTATTCGATTGCATCCTGGTCGTCCCGTAATTGTCACGGTATCAACCAGAGATTGACTGGTTGGCCCGCTCGGTTAAACACCGCAGCGGTTTCGACGTG
AGCGAGGTGTTCACCCACCTCCTGGTTGCCCAGAAGGACTGGCCCCACGTCACCGTCGTGGACCGGTCGTCCACGACGCAGGCTGTACACAGAGTGAGCG
ATGGCCCTCTCTGCACGGCTTGCGCAGTGCTGTTGCACGAAGACTCCTCGCCGCGAGGCGAGGACAAGAACACGATGGCGGTCGAGCAGGGGCTCCCGCA
ATACGAGCAAGCGGTCGAGCATGGGTTCCCGCTGCGCACAACTGCGGTCGAGTATGGGTTCCCGCGGCGCACCACAGCGGTCGAGCATGCGTTCCCGCAG
CACAACATGGCGGCCGAGCATGGGCTCCCGCAATGCAACACGGCGGTCGAGCAGTCGAGGCTCCCGTCACCCGAGCCGGTGGTCGAGCAGTTGGTGCTCC
CGCCGAACGATCACGCTGTCGAGCAGTGGCCCCCGCGTGTGACTGGCATAGTCAAGAGTGAGCTCCAGTGCCTAGAGCGGGGTGATACATCGTCCAGCGA
GAGCGATTCTTCCTCCTCGAGTACACACTCGAGGCGCCGGGCAAAGAAGTCGAAGCGCCGTCGTTTGAAGCCACGACGTGAAACTGCACCGAGCGGCACC
TCACAGACGGAGTCGGTCTGTGTCATTGAGCACGTGGACGACGACATGGGCCGTCAGCACACCGTCGATCTTGCGTGTCCACGTCGAGACGCTCAATCGA
TCACCCGGCTTCCAGGTCTCTCCTGGAAGAACTTCCTTCGTGGTCTCAAGGTTGGCGAGGTTAAGCAGGTCTGCCTGATCACAGACACTTCGTCTACGCC
ACTCGAAGGGAACGCCGTCAGTGATGACGACGGATCCACCCGTCCCAAGAGCGCCGAACCGAAGTCCGCTCGCGAGGACCGATTCGCGACGCAGTCCTGG
GAGTCCTTGCGCGAGTCTGGTAATCCAGTGTACGAGACCGTCCGCCGCGGACGTCTTCTCCGATAAGATTCCACCCGAACTGCCTGCCGATCGAGGCGTC
CGCCACGAGATCGATCTCGCGCCCGGTTCGAAGTACTGTGTGACGCGGCAGCGGCCACTGCCGCGAGACCAAGTCAAGGCCATCGACGACTTCTTCGAGA
ATCGCCGTAAAGCGGGTCACGTGCGTGAGAGTGTCTCTCCACACTCGAGCCCAACGTTCTGTGTGAAGAAGGCCACAGGCGGATGGCGTATCGTTCATGC
CTTTAGCAAGTTGAATGATGCGACCATCCCTGCGCAAACCCCAATCCCCCGGAAGGACATGGTGCTTGACACCATGTGGGGCAGTGTCGTCTTCAGCGCC
ATCGACTTGACCGACGGATTCTATCAGATCTTGATGAGACCGAGCGACATTCCGCTGACAGCGGTCAGCACCCCCAGCGGTATGCTCTGGGAGTGGCTTG
TGATGCCACAAGGCTTGAAGAATGCTCCCGCCACGTTCAATCGCATGGTCTCCCATGTGCTGCGTCCGCTTCGAGACTTCGCACCGAGCTGCTTCGACGA
CATCTTCGTGCACAGCCGCGCTGAGGGTGGTCTCAGCGCGATAGAAGTCCACTTGAAGCACTTAAAGCAGGTCTTCCAAGTGATGCGCGAGAACAAGTTG
TACGCGAACCTGAAGAAGTGCATCTTCTGCGCGCCTGAGATTCCGGTGCTGGGCTGCTTCGTGGGCAAGTACAACGTTCGCGCCGACCCGGAGAAGGTGT
CCTCTATCTGCGTATGGCCGACACCAAAGAACCCCACTGAGTTGCGTCATTGGTTGGGACTAGCGAATTATCTCCACAAGTACACGAAGAATTACGACGG
ACTGGTCCACCCTCTCTCATCACTCCTGAAGAAATATGCCACATGGGCCTGGTCACCCGCGCACCAAGCCGCCTTCGACTCAGTGAAGAAGAGCCTTGCT
GAGGCGCCGATCCTAGCTCTTCCCGACGACTCGAAACCATATCACGTCGTTTGCGACCCGAGCGACTTTGCCATCGGCTGTGCGCTGATGCAATTTGACG
ACGAAGGTCGTGAGCGGGTCGTCAGCTATCAGTCTCGGCAGATGAAGCCAGCGGAGCGCAACTATCCTGTCCACGACAAGGAGCTTCTCGCGATGCGCTA
CGCTCTGATCAAATTCAGAGTGTACTTACTCGGCGAGCATACCGATCACGCATCGCTGAGGACAGCGATGAAGAGCCCTCATCTTTCCCAGCGAATGGCT
CGCTGGTTGTCGTTCTACTCCGAGTATAACTTCGTGGTTCACTACAACCCGGCAAGAACAACATCCTTGCCGATGCGCTGTCTCGTCGTCCAGATTACGA
CCCACGCGATTCGCTGGGTCGACAACCGCTGCATGATGAAGACGACGAAGGCAACTGTGCTATGTGCTTGGCGTCGGTATTGAACCTGAGGAGCGTGTCT
CCAGAAACCCCACTTCGCGACGAAACCGGACTGCGTATGAATTCGATCTGGTCTATTCGAGTATTTTGAAACATCTCCTACTCGCCCAGTGGAAAGCCAC
TGAGTGCTTTGTCCCGCTCCACACGCCATCAGATCGATAGGTATCGGATTGAAGACGGGCTGTTAAAGTACACCATCGATCGCTTCGATGCTTCGCGTGT
AGTGGTCCCCAACGACCCTGACTTGCGCTCACGGATCATCCATGAGTTCCACGATATCCCACTTGGCGCTCACTTGGGCCGTGAGAAGACATTCGCCGCT
GTGTCGCGCAACTTTTACTGGCCCCACATGTATAAGTGGGTGCGCAAGTGGGTGAGCACCTACGAGATCTGCCAACGCGTGAAACCGTCCGCGTCACCGC
AGGCTCCCCTGCGTCCTTTACCAGTGGCCACCGAGGCATGGCGCTCGGTGTCGATGGACGTCATCTTCGGCATCCCACCCGACTCCGCCGGGCGCTCCGG
TGTCCTGGTATTCGTCGACAGGTTCAGCAAGATGGTTCACCTCATTCCGGTCCCGGATACGATCACCGCGGCCGATACCGCAGTGCACTTCGTGGATGCA
GTCTTCCGTCATCATGGCATGCCCGAGTCTATCGTTTCGGACCGCGATCCGCGATCCGCGGTTCACGTCTGCTTTCTGGACGAAGCTCTTCGAGCTATCA
GGGACAAAGCTGCTGATGTCGACGGCTGCTCATCCGGAGACGGATGGCCAAACCGAGCGCGTTAATCGCGTCCTTGAGGACGTACTTCGCAGTTACGCGA
CGTCGTTCACGAGCTGGAGCTCGTTGCTTCCGCTTGCTGAGTTCGCGCTGAACAACGCGGTTCACGCGTCGACTGGCCTGACTCCTTTCTTCGTCAACAA
CTCTCGGCACCCTCGCGTTCCAGCTCTCCTCGCCGTGGGCCGTCCCACGGCGCCGTGTGGCTCCACTCTGGGTGGGGGTGAAAGAGGCGACAACCACTTT
GTGACGACTCCGGTTTCGAACCCACAACCGGTTACCATACCGATTGCCGACAAGCCTTCTGCGCCAACACCGGTAATGGACCCTCAACTGGTTTCCATAC
CGGTTGCCGACTCCTCCTCGAGTGCAGCCGCATCTTCAGCGACTGTTAACGCAGTGACACACGCCCAGGCCAGGAAGGCCCTGACGCCTCCCCGCGACGC
GGTGTCCCCTCTCGCCTCGTGGACGAATCGTGCCCTGTTCACTCCTGGCACCGCTAACGCGGTGTCTCCATCAGCGAACTACGCGCCAAAGCAACCGGCA
CGTCCGGCTGACAACACCGCTGTCTCAGACTTCCTCCTCCAGCGCCAAGCAGTCGCCCGTTACGTCCGCGACGCGCTGCAGACGGCGGTCGACAAGCAGA
AGGAAAATGCGGACAAGCGCGGCCGCAAACACATAGTAAAGTTCGCGACAGGAGATCGAGTGTTCCTGTCGACTTCAGGAATCAGAGACTCTGCCGTAAC
CAACCTCGGCGCGAGTAAACTCGCACCGCGCTTTATTGGGCCATTTACGGTGACTAAGGTTATTGGCGAGGCTTACACACTGGATATACCTACGTCGCTG
CGGCTACATCCGACGTTCTACGTCGGACGACTTAAGAAATACCTGC