Description :
From Genome Similarity Track
Location :
contig_32:554121- 556366
Transcript NameFunction/comments
g6269.t1hypothetical protein
g6270.t1hypothetical protein

Sequence
2245 bases(100 bases per row)
CGGTCGCGACCCCGGCGGCCACGACTGGTACCCCTGCTACGGAGGCCCCGGTGGTTGAGACTGAGGCCCCGGTGACGGAGACCGAAGCCCCCGTGACCCA
GGATGACACCACCCAGCAGACCGACGTCGCCGGTGAGGCCGACACGTCGGTGCGGGCTCGGGTGATGCCACCCAGGGCTCGGACGCCACGCAGCAGACCA
CTCAGCAGTCGACCATCTCGGGTGCTGCCCAGTCGTCGGCTGGCACTGTCTCGAGCGCGTACTCGTACACAGGCGTGAACTGCGGTGGCCCCGGCTCGTA
CGACCAGGTGACGGACATCGGCTCGTGCACCAAGTCGTCGGTGACGACGACGAGCCCCGTGTCGCCTCTGGACTCTGGAGTCACGCTCGCCTTCCGTGGC
CCCATGACCATCTCGAACATTGCGGTGTTCGACGGCAACAACGGCACGTGGAGCAAGGTGTCGTCGTACGAGAACGGCGGTGCCGCCACCAACATGGTCT
TCCTCAACAACGAGAACGTCGACTACACGGGTGCCGGCTCGCCTGAGGGCTTCTGCGAGGCCAACGGCGCTGGTGTCGCCCAGCAGTCCACGCCGTTCAC
CGGCACGCTGGCGGCGGCCACCAACCCGAAGAGTGGTGCTATCCTCGCTTCGGAGGCCACGGGTGCTGAGGTGCACATCATGACGGAGAACCAGTGCGGT
GTGGACGTCGAGTGCGAGGGCGCCTACGACACGGACGGCACGGCCTTCCAGGGCTGGACCGGAGGCAAGAAGATCTTCGTCACGAAGGTGTCGATGGAGA
ACGGCGGATCGCCCGATGTCCCTGCTATTTGGATGCTGCCTGACCAGGTGACCCACTCGGGCCAGTACGGCTGCAACTGCCGTGGCGTCGGCCCTGCCGG
TGGCTGCGGTGAGCTTGACATCGCCGAGTGCTGGAGAAGGACACGAGCTTCGTGGCCACGCACTTCTACTTCTACGACGGAACGTACAACCCGGGTAACG
ACCAGTTCGCCCAGCGCCCGACGTCTGGCCCGGCCACCTACGTGACCATCGTCGACCAGGACTACGGTGTCAAGGTGCTCGCGATCGGCGCGGACGACTT
CGACTTCAGCTGCGGCTCCATTACGGACGACGTTGTGTCGCAGTGGGAGGCCGCCGAGTAAACTCGTTGTTGAGTTCCTCTTTTTGTGTATAGCCTCAAC
AAGCTTTAAGCTGTCACGTTCCCCGATCGCAGGGCGGATTGCAATAGAGTTGTTTGACGTCGGAACATCTCTCTCTTGTATTATGATTGTCTATTTGCTG
TCGCGTGATGGCGGCCATGAAACGTGGACAAACAAACGCTCCTTTTATTGGACCGACGTGAAGTCGATCACGACCTTGGCACTCTGCAACTTGTGCTGCG
AGTACTTCACACCGGCCATGTCCAAGAGCCGGCGAGATGCCACGAACTTCCAACTGCAAGTGAGTCAACAAACCGTTTAGAGATCAAGCCATCATCTTTG
CATCTTCCAGTGAGCACACATACTCGTGATTGTATTTGTCGGAGCAGTACACGACCCGCGAGATGCCACTCTGCATAAACACAACCGAGTTAGACGAATA
TCTGAAGTAACTGCACACATGACACTTCAGTACCTGGATAATGAGCTTGGCACATTCATTGCAAGGGAATAGCGCCACGTAAATCTGCACGAGCACGCAA
CAGTGAGATTGGGCAGCAACCTACAACCCACATCAAAACCCAAATATTCGTACAGTGCATCCTTTCACGTCAGTGGAGTTCTTGTTCAGGATGGCGTTCA
TTTCTGCGTGACAAACATACTGTGCAAAATGAAATTAGCCATGGATCTGGCAGGAAGACGGTGCCCCCACCACTCCTACGTACCGGGTACTTGGTATCCA
GCGGCGAATCGGTCGCGCTCTCACGCGCCCATGGCAACTCGTCGTCGCCACAACCATTTGGAAATCCGTTGTAGCCGATGCCCACAATCTTGCGCTCAGG
GCTCACAATACTAAGGCCCACAGCACCTCGTCAGTCTCATTCTCTACACCCAAACAGTGCGCAACCTCACCATGCACCCACTTGCGTCGAAGGGTCTACC
CACCCACAAAAAACAAAACTTCATCAGGACACCTTTTTTCAACTCGCTCAAAAGTACCAACCTTTCGAGCGCATGGCACTAAGGAACGCGACGCTCATGA
AATAGTCATCCACGACAAATAGTCGGAACGTTTCTGCACTGGCGC