Description :
From Genome Similarity Track
Location :
scaffold_548:5540- 14925
Transcript NameFunction/comments
Pl_103919hypothetical protein PHYSODRAFT_314592

Sequence
9385 bases(100 bases per row)
GGAGCGTGCTGCTTTGCGCAAACAGTGCCGCACACTCACGAATTTCTTGCGACTTGCCGACTTCCTCACAATTGATGCTACCATTCAGCTCACAGTTCAC
TCTTTTCAACGCCTGTACATCATACTTACTGCGGGAAAAGTTCAACTTACAGGTGCTGTATCGGCGACTACTGCTACTCTTGCACCTACTGCATCTAACG
CGAAGCAGCCAACTTCAGGTGGAACAACGCAGTCAAACAACCGAAATGCTGGTAAACCTGGTCAAACAAATGTAGCTCCACCATTCACAGCCATTTTTGC
GGTAGCAGTCGAAATGGATGCTGTCACGTCGGCTTTGAACGCCACTCCAAACCACGATGCGTGGAATGGAGCGCTACAGCGAGCGTTGAAAGAAGCATTA
CGAATGGTGGAGACTCCAGCACGACATCTCGGACATGAGTCACTTGCACCTTACACGACCGCTAGTGCAGAAGACGAAGGCAAAGACGTTTGGTCGGTTG
AACAACTGAATGTAGCTCTGATTCTCAACGACGACACGAAGTTTAGTATGCTTACCAATGACATTTTTGTCGCTTTGGATGAGGCTTTTGAGGCTGTAGA
GGATTATATGGACGTGTTTGCTCCATTCCACCAGATTTACTCGGAAAACGAAGGACAAGTTACTCAACTCATGGAGACGTACGCTAATGCACCGTTGGAC
TTTTTCTCAGAGTCAGTGGAGAAGTACAAGTCCCAAGGTCAGTCGTTCATGGAAATTCCCGATGCTGCCACCGTCGGCATCTTTCGTGTAGATTCTTCGG
AGTTCAAGAGTCGACTTCTTCCAAACCCTGAGAAGTGCATTCTCGGTATTCGTGCACTTCTTCCCAAACTCATGAAGAAAACCAGTACAGCACTACTCGA
GACTCTCAACGACTTGTCACCCGTGGCATTCTCGACACCATCTGCACCCGATGCCTTTGTAAATAAAGTAGTGCATATGACGAAAGTGAGTGCAATGCTT
CCAGACCTCAGGAGCCGATATCGTCGAGTGTACGAGATGGGAGTCCTCATGGATAACTACGACTGGCGCGTACCAGATGACATCAAAGAGGATATTATCC
TCATGAAGGAAGGTGTGTTGAGTTTGGAAGGGACTGTCACACGTTTTGAAGGAGAGATCGATTCCGAGACAGCCCGATTCTCACAAGTTATTCTAGATAG
TATTGCTCCGTTGAATCGCAATGCTAATATGCTCCTTGAGAAACTGGATCATCCCAAGCTGTCGACAATCAAGACCCCTATGAGTGAGGCGCTTTCGTAC
CTCCAAGCCCAAGAAGATACACTTAATCAACTCGTGGAAGAATCGAAAAAGCTTGCAATGTTTCAGACGCAACTCAAGCAAACGGTGAGCGAATTTAATG
AAATCAACGAAGTGGCAGCTCACTTTGAGCTGAAAATGAAGCTTTGGAGTGGTTTGGATACGTGGCAAAAGCTTGCTGTCTCGTACGTCGATACTGTCTT
CGATGACATTGACGTTGGTGCAATCAGCAAACAGGTTCAAATGTACGTTAAAGTGGCATATCAAGCTCAGAAACAACTACCAGGAAACGAAGCTGCTGAT
CTGCTTCAACGTGAAGTGGAGAAATTCAAATTGGTGCTTCCTGTGGTGACCGATTTGAGGTCTCCATCGCTCAAGGACCGACACTGGAAACAGATTCATG
CAGCTTTGGGATTCCAAATGAAAGGCGAGAGCAGTATGACCCTCGGTGGATTGATTGAGAGAAACGTCATGAAACATGGAGAAACGATAAGTGCTGTGGC
TGTATCAGCTCAGCAAGAAGCTGTACTCGAGGAAATGCTGAAGAAAGTTACGGACGCATGGGCTACCACCGAGTTTGAGGTAAAACCTTATAAGGAATCG
AAAGATGTTTTCGTTCTGGGTAGTGTTGAGGAGGTCACTGCGAAGCTAGACGACTCGATCGTGATGATTAGTACGATCATGGGCTCACGATTTATTGGTG
CTATTCAAGAGGAGGTGGAAGGATGGAGAAAGAAACTCGTGACACTGCAGGAGACACTCGACGAATGGCTACTCGTGCAAAAGAATTGGATGTACTTGGA
GAATATCTTCTCGGCTCCAGATATTCAACGCCAACTACCGGATGCATCCAAAATTTTCAGTCACGTTGATGCGTCATGGAAAACTATCATGCGTCGTACC
AACGAGAATCCACACGTGTTAACTTCCGGTACATTCCCTGGTATTAAGGAGACGTTGCAGCAGCATAATGCACATCTGGACAAGATTCAGAAGAATCTAG
AGGACTATCTCGAGACGAAGCGTATGGCATTCCCTCGATTTTACTTCCTGTCCAACGACGAATTACTAGAAATCCTAGCGCAATCCAAGAATCCGCAGGC
AGTACAACCTCATCTTCGCAAATGCTTTGAGAACCTCGTAAAACTTGACTTTGGTGACGTACCCGGAAGTGTCGACATGATAGCGATGTATTCGTCTGAA
AACGAGCGAGTACCTTTAGGTAAAAACTTAAAAGCACGAGGTAACGTCGAAGACTGGTTGAAGGCGCTTGAAGTGAGCATGAAGCAGTCAATCTACAAGT
TGATGAAAGCAGGTCTTCTGGATTACGACACAAAGGAGCGGTCAGTATGGGTGTGCGATCACCCTGGACAAGTGGTGGCTACTGTGGCGCAAATGACGTG
GGCACGCAGCACTGAGGAAGCTCTAAACAGCAGCAATCCAGTTGAGGAGATGCACACCTGGTATAAACGCAATCTCTATGAGCTGAATGAACTTATCGTG
AAAATTCGTGGAGACCTCAGTTCGCTGGAGCGCAAAATCATTGTAGCCTTAGTGACCACAGATGTGCACGCACGTGATATCGTAGAGAGTTTGTGGACTG
AGAAAGTGGACTCAGTTGGCAACTTCATCTGGCAACAACAACTGCGTTACTACTGGGACGCGCAGGCTGATGATGTCCTCATTCGTCACTCCGACTCCGT
CATTCAGTATGGCTACGAGTACATGGGAGCTACGTCTCGACTAGTGATCACACCGTTGACAGATCGTTGTTGGATGACACTTACAGGAGCTTATGGTATG
AAACTTGGTGCAGCTCCAGCAGGTCCAGCAGGAACGGGCAAAACTGAGAGTAGTAAAGATCTGGCAAAAGCCATGGCGATCCAGTGTGTTGTGTTCAACT
GCAGTGACCAAATTGACTACAAAATGATGGGGAAACTCTTCCGTGGTCTCGCACAAGCAGGAAATTGGACGTGCTTGGATGAATTCAACCGAATCGATAT
TGAAGTGTTGTCTGTGGTTGCTCAGCAGCTACTGATCCTGCGTGAAGGACGTATTCAAGGCAAAGAACACATCAACTTTATGGGTATTGAAATCCTCCTC
AAGGATCACCATGTAATCGTGACGATGAATCCTGGTTACGCCGGTCGTACAGAACTTCCCGATAACCTAAAGGTGTGCTTTCGACCTGTATCCATGATGG
TTCCCGATTACGCGCTGATCGCAGAAATTATGCTGTTCGCTGAGGGATTCGGCGATGCTCGTACGTTGTCTCGAAAGATGTGCAAGCTCTACATTCTCTG
TAGTGAGCAGCTATCGCAACAGCCTCATTACGACTATGGTCTTCGTGCTGTGAAGTCTGTGCTAGTTATGGCAGGTTCACTCAAGCGTGCCAACCCCGAC
TTGAATGAGGACGTCACATTGATTCGAGCACTCCGAGACAGCAACATCCCAAAATTCTTAGCTGATGATCTGCCACTGTTCCACGCCATCGTACTTGACT
TGTTTCCAGGTACAGACATCCCTCCAAATGACTACGGTGAACTTCAGACTTCTCTTGAAGAAGAGATCACGAAGGCCGGATTGCAAAAAGTGCCAACTTA
CATCACGAAGGTCATCCAGCTCTTCGATATCTTCAATGTTCGCTTTGGTGGCACACTCGTTGGACCCACTGGTGCAGGAAAAACCTCCTGTTATCGTACA
CTCCAGTCCACAATGATATCGCTCCGTGCAAAAGGCTCGAAGAATCCGGTGTACCAAACTGTGTACGCTCGAGTACTCAACCCAAAGTGTATTTCCATGG
GTGAGTTGTACGGTGAATTCAACGAAGCAACGCAGGAATGGCACGATGGTTTGGCCTCCACGATCATGCGTGAAGCTGTAGCGGATGAAACTTCAGATGT
AAAGTGGACGGTTTTTGATGGACCGATCGACGCGCTGTGGATTGAAAATATGAACACAGTGCTTGACGACAATATGACTTTGTGTCTCGCGAACGGAGAG
CGTATCAAACTCAAGAGCGAGATGAAAATGCTTTTCGAAGTCATGGATTTGGCGGTGGCTTCTCCTGCGACTGTGAGCCGTATCGGTGTTGTGTACATGA
CAGCAACGGATTTAGGCTGGATGCCGTTCGTGAAAACTTGGATGGAAAAGGAACTACCCTCAGATTTTCCACCTGATGGTCTCAAGCGATTAGAATTCCT
TATCACCAGTTACGTGGAGAAGTGTATCCAGTTCGTACGCAAGAAGAGTTTCGAGCTTGTTCCGACTGTGGATATGAACCTTGCCACGAGTTTGTGTCAG
CTGTTCGCGTGCTTGTTCTGTCCTGCGCGTGGCGTGAATTATTCCGAGATGAAAACGGAGGAAATGCTTGAGCTTCTGGACAAAGTTTTCGCTTTTTCAC
TCTTTTGGTCTGTAGGTGCAACGATGACGGTCGATACTCATGAACAATTCGACAACTTTGCACGTGAATTGATGGGTGAAGCGAAGCTTAGTATCCCAAA
TGCTGGTCTTGTGTTTGACTACTTCGTCGACATCGAGCAAGCCAAGTTCCGTGCATGGAGTGAAGTCGTACCGAAATTCCAGTACAATTCCCAAGTGCCT
TACTTCAAAATGACCGTGGCTACCCCTGATTCCGTTAGGTTTACCTTCCTGTTGCGCACTTTGACAGCAGCAAAGAGACCAGCATATGTGACTGGTGTCA
CAGGAACAGGCAAAACTGTAATTGTTCAGGATTTGTTGCAGGAATTGACGTCTGGACCGATGGTACCAAGTGGTGACGCAAATGGAGAAGGAAGCGAAGC
GCCATCGGCTCCAGCATCAAACTTCATGACGATTTTCATCAACTTTTCCGCACAGACATCGTCTCTAGTCACGCAGTTGACGATTGAGAACAAACTCGAG
AAGAAACGCAAAAACTTGTTGGGACCTGTAGCTGGCAAGCGAATGATCATCTTCGTCGATGATGTAAATCTTCCAGCAGTCGAAGAATACGGCGCACAAG
CCCCAATTGAACTATTGCGTCAGTTTCTAGACTTCGGTGGGTTTTACGACCGCGACAAACTCTTCTGGAAAGATATCGCAGACACAATGTTGCTTGCTGC
TGCTGCCCCTGCAGGTGGTGGTCGATCACACTGCACACCGCGCTTTGTACGTCATTTCCACGTCTTGAGCATGTATCCGGCAGGTGAAACTTCGCTCAAG
CTCATCTTCGCTTCAATCCTCGGAGGTTTCTTTGAGAAGTTTGCACCCTCCGTGAAAGCCATGAAAGACGGTATCATCTCGAGTGTCATCGAGATCTACA
ACCGCGTGACGCTGGAGCTGCTACCGACACCAAACAAATTCCACTACACGTTCAACCTTCGTGATGTATCCAAGGTATTTCAAGGCATTCTCATGATCAC
TCCTTCAAAATGCCCAGACGCAGACTCGATGAACCGCCTTTGGGTCCACGAAGCTTCCCGTGTCTTCCAAGACCGACTTATCAATGCATCCGATCAAACT
TGGTTCGAGGAACTTGTATGCTCCTTGCTTCAGCGTTTTTTCAACTGCAACTGGGCACGAGAGACACTATTCCACTCGCCTTGTCCGTTGACATTCGGTG
ATTTTTTTAAGCCAGGAGTTCCAACTCCGCTTTACGAGTACTGCAACGATGTATCTAAGGTTACCAAGATCATGGATGATTTCCTCGAAAACTACAACGT
GACCTTCGCGAATAAAATGAACCTCGTATTCTTCCGAGACGCCATCGCTCATTTATCACGACTGGTACGAATTTTACGTCAACCTCGAGGCAACGCAATG
CTTATCGGAGTAGGTGGTAGTGGCAAACAATCTCTTGCTCGTCTGGGTGCATTCATGGTGGAAGCCAAGTGTGTACAAATCGAGATCACTCGCGGGTATG
GGGCCAATGAATTTCACGAAGATCTTAAGAAACTCATGATCAGTGCTGGAGTTGGCGGTCAATCGACTGTTTTCCTATTCACCGACAGCCAAATTGTCGA
AGAGAGTTTCTTGGAGGACATCAACAACGTTTTGAACAGCGGAGAAGTGCCAAACTTGTTCCCGCAAGATGAAATGGACCGCATTATTGGGGACATGCGG
CCAATTGTCAAAGCGATGGAAATCCCTGAAACACGTGACAACTGCGTGTCCACATTCATTGAGAGAGTACGCAACTATTTGCACATTGTGCTAGCCATGT
CACCCGTTGGTTCAGCGCTTCGTGTTCGCTGTCGAGCTTTTCCATCGCTGATTAATTGTTGCACTATTGATTGGTACATGAATTGGCCACGTGAAGCACT
GCAGTCTGTGGCTGATCGATTGCTTGCCAGCGTGTCATTGCCATCTGAAGATGTCCGAACAGCACTTGTGGACATGTGCTCAATTGTGCACACGACATCC
AACGATTTTGGTGAGGAGTTCCTGTCGCAACTGCAGCGCTACGTGTACACTACGCCCAAGAGCTACTTGGATCTCATCGGATTGTATCTGAAGATGTTGC
AGGAGAAGCGTGCCGTATTACAAACGATCAAGAATCGCATGGAAGTTGGTGTCAAGAAGCTCGAGGAGACAAACAGCATCGTGGCAAACGACCAAGAATC
GCATGGAAGTTGGTGTCAGGAAGCTCGAGGAGACAAACAGCATCGTGGACTCGTTGAAGTCCGAGTTGATTGAGCTACAGCCGATCTTAGCAAAGAAAGC
CATCGAAGCTGAGGAATTACTGAAGCTGGTGTCCGTGGATCAGAAAGCAGCAGCAGTTGTGCGAGAACGAGTCTCTCAGGATGAAGCGACAGTCATGAAG
CAAGCTGACGAGGTTGCACTAGTCCAAGCCGACGCTCAGAAGGATCTTGATGTGGCTATGCCAGCGCTCAATAACGCTATCAAGGCACTAGATAGTTTGT
CCAAGAATGACATCACTGAAGTCAAGTCCTTCGCAAAACCTCCAGAGGCAGTGGAGACGGTCATGAACGCTGTGTGTCTTCTCTTTAATGAAAAGCAGAG
TTGGGACGGCGCCAAGAAAATCTTGGGTGATGTAGCCTTCCTGGACAAGCTCAAAAACTTCGACAAGGACAATATTCCAGCTGCTACGCTTAAGAAATTG
AGCAAAGCAGTATCGGAACCAGGTATGGCCGTGGAAGTGGTCTCGAAAGTGTCCAAAGCTGCTACATCGTTGTGTATGTGGGTACATGCGATGGATGTGT
ATTCCAAAGTAGCGAAAGAAGTTGGCCCCAAGAAGGAAAACCTTGAGCGGATGAACCAAAAACTCGCCGAAGCGAACGCGATTTTAAGTCAAAAGCAAGA
AGAACTTCGCGTTGTCAATGAGAATGTGGCCATGTTGGAAAAGCAGTGCAAAGATACCCTTGACGAGAAGGATAAGCTCGCAAATGATGCCGCTGTGACG
GAAAAACGACTGGTTCGAGCTGAGAAGCTCATTTCTGGATTATCAGTGGAAGGTGCTCGCTGGAAAGAGAGTGTGGCATCGTTAACCGAGTCCATTTTGG
CGCTGATTGGCGATACGTTCTTAGCTGCAGCTTGCATTTCGTACTATGGTCCATTTACTGGAGGGTTTCGCCAGCGAATCGTGGATCAATGGGTAACTCA
GACGCAGGAACTCCATATCCCTTGTTCTCCAGGCTATAGTTTGTCTACTACACTAGGCAGTCCGGTGGAAATTCGCGAGTGGCAGTTAAATGGCCTCCCT
ACAGATTCAACATCGACGGATAACGCCATCCTTGTAACTCGAGGTGAGCGGTGGCCTCTGATGATCGATCCACAAGGTCAAGCGAACAAATGGATCAAGA
AAACCTTGGCTCAAAAACTCGAAACCACGAAAATGACCAACGCCAATCTGCTGCGATCGCTGGAAACGTGCATCCGTAATGGTAAAGCACTGCTTATCGA
AGACATTGACGAGACGTTGGAACCATCACTTGAGCCCATTTTGCAGAAGGCTATCTACAAACAAGGTGGACGTGTGTTGATCCGTCTCGGCGACTCCGAT
GTGGACTATGACCCAGCCTTCAAACTTTTCCTCACGACGAAGCTACCGAATCCGCACTACCTCCCAGAGGTCTACATCAAGGTGACTGTCATCAACTTCA
CAGTCACAATGGACGGTTTGGAAGATCAACTTCTTGGAGATGTTGTGCGTCACGAGCGTCCAGACATTGAAGAGAAGAAAAATCGGCTGGTTGTCACCAT
GGCTCAGGACAAGAAACAACTAAAGGAGATTGAAGACCGCATCCTCAAGCAACTCTCGGAGTCATCAGGCAACGTTCTGGACGATCAAGACCTTATCGAT
ACCTTGCAATCGTCAAATGTCACTTCCCGTATCATCAAAGAACGTGTTCTGGAATCCGAAAGCACTGAAATCGAGATTAATCGCACACGAGAGGAATATC
GCTGTGTTGCTACGCGGGGATCAATAATCTACTTTGTAGTGGCAAATCTCGCACTCATCGACCCGATGTACCAGTACTCACTGCCATTTTTCCAGCGCTT
GTTCAATATTTGTTTTGACGAAGCTCCGAGGGCTGACACACTCCAGAAGCGACTCACGAACCTCATTGATTTCCAAACACGTTACATCTACGTGAATATC
TGTCGTGGACTCTTTGAGGTGCATAAGGTGCTCTTCTCCATGCTTATCTGCTGCAAAATCTTGCTGCACTCGGGAAAAATATCGACACGAGAGTGGTCAT
TTTATCTACGTGGAGCTCCACCAGGTGCTGATCGCTCCACACAGCAGCCAAACCCACAGCCAGCACACATCACAGAGGCGCAATGGGACTTGATCTCAGA
ACTTGAGACGGTGGTCACCAGCTATACTGCAGCTACAGAGGAGGTGGAAGCGGATCAGAAGATGGAAGTTCACGCTTTTCAAGGTCTTTGCACTTCGTTG
ACCAACGTCTGGCCGCGCTGGCTGACATGGCTTGAAGATCCCGACTTCTTGTCGAATCCCAATTCTTGTCCCGGTAACTACGGATCGACCCTTAGCGCAT
TCCAGAAGGTGTTGCTGTTACGAGGATTAGCCGAGGAGAAGGTTCCTCAGGCTGTGTTGAACATGATTTCAACTGAAATGGGAGC