Description :
From Genome Similarity Track
Location :
Scaffold_1801:5540- 6930
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1801-fgenesh-gene-0.1Elongation factor P

Sequence
1390 bases(100 bases per row)
AGACCTTCTCGACAAACGCGCCGTCCTCGGTCGTGATGCGGACCTCGTTGCCCACTTCGACATAGAGCGGCACTTTGATGACAGCGCCGTTCTCGAGCGT
CGCGTCCTTGACGCTGAGCGCCGAGTCGGCCACGCCCTTGGCTGTCGTCTTGACCACCTTGAGCGTCATGTACTCGGGCATGTTGGCCCAGAGCACGTCG
CCGTCCACGATCTGCAGCGACAGCGTCATGCCCTCGATGAAAAACTCGNNNNNNNNNNGGGTCGAGCCATGCGCATATGAAAGTTACAGTGTGCTCTTCG
TACCTGCTCGAATGAGGTGGTGNNNNNNNNNNGCTGGCGGTCCGAAAAGAGCTCGCTGTCGACCTCCAACTATCGATTTCAGGCCCACGCAGTCGGTGGT
TAATGTCCCGGTCGAGCTATGCTCATATGGAAGTTACAGTGTGCTCTTCATACCTGCTCGAATGAGGTGGTGTGCATCAGCAGTATCTTGTCGCCCTCGC
GGTACAGATATTGGAACGTTTGGTCGGGGCCGAGCGCGGCCTTGGCGACGCTCTCGGCCGCGCGGAAGCGACGGTTCGTCTTGCTGCCAGTCTTGATCTC
CTTGAGGTCGCACTGCACATACGCGCCACCTTTACCAGGCTTGACATGCTGGCTCTTGGTCACGCGATAGATCTTGCCGTNNNNNNNNNNGTACGCGCCA
CCTTTGCCAGGCTTAACATGCTGGCTCTTCGTCACGCGATAGATCTTGCCGTCAAGGTCAAGTGCCATGCCCGTGCGGATCTGGTTGCCTGGCGATCACC
AATGCCAATGGATCAGATCGCATACTGCATCCATAGAAACGAGCGATGGGTAAGTACCATTGATATGAGCGAAGCGCGTGCCCGTGGGGGCGCGCGCCGC
TCGCNNNNNNNNNNNTGGTGGTCTCTTTCGGGATGGATATCGCGCGGGGCTTTGTGGCTCGGCGAGAGTTGGGGTTCAGCAAGTATGTGATTGGCTAAAA
TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATGCCGACCGCGCAGGCCGCTACGAGGCCGCGGTGGATTTGTACACGAAAGGCATC
GAGAAACTGCTCGAGAGCCTCAAAAGTGAGGAGCTCTTTCGCTTTGATATCGGGCGCCTTCAATGTCTCACGTTGATCGTTCTCCAACAGCCATGACAGA
CGAACAGGCACGCCAGGCTGCAGGGCACAAGATAGATGAGTATATGACGCGCGCCGAGTTGCTGAAGGCCCACATTCTCGAACAGAAGCG