Description :
From Genome Similarity Track
Location :
Scaffold_1969:554- 1899
Sequence
1345 bases(100 bases per row)
GGATCTCAATCCGGCGATCCCTCTGTAGGATCTTTCGCGGAGTTGGGTATGAAGGCCGATCTACCAAGGGACCAGTTGGCTCCGCCCCCCCCCCCCCCTC
TCCGAAAAAATCGAACTCGGTAGTCGCCTTCAACGCCAAAATCTTTTCTTCTCTGGAACGACAGGGCCCCCCTGATGAATATCCAGGGAGGCCAGGGATA
CCGTCCTTAGCTAAACATCACCCAAACTCCTTCTAAAGGACCCGAAAAAGACTCTAGACGCTGACGTTCGGGACTGGAGGGATTGTGATCGACCTGGGCC
TTGGATTACTGTAGGCACCCACTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTCAACCGGTCTGGCAGTTCCCAGGTTTCTCCGGGT
TCGATCAAGGTCGTCTTATCCGTCCTTATGATCCTCATCTTCGCCCCGTACAACGCTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCTGGAAAATACA
GTGTCCCATCCGCCAGATCCAACCTCACTCCGGCTGGTACCATGAACTCCATTCCGAGGATGGCGTCTTGACCAGCAAGATCTCTAACCCAAATATCGAA
CCAGTACACCAAACAGCCTGCCAACGTGACCTTGATTCGCGTTTTCCCGTTTGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTC
CCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTTTCTAGGGGTAGGATTGCTTTTTCATTGTTGATCT
TGCCCCCTACCTTGGCTTGCCTGAACCACTTTCCTGGGGCATGGTATTTCCAGTATCCACGGGACTCCTCGGTTAGCAGATCCATGGATCCAACATCCTC
AGATCCACGGGATCCTGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAA
TAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGCTGAAGAGATTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACA
CTTCATGTAGATCACGTGTATTATTGACTGGATGTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATTAATGTAGTACCTAAAAAA
CTCTCGGTCCTCTAGCGGAATTCAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCATTCTCTGTGAGAGTCTCTCGCGTGCTTGGCTGGAATCCA
ACCATGTGGCGAACTCGTTTGTAGAATTTCTTCATCGGACACTCT