Description :
From Genome Similarity Track
Location :
scaffold_7:55390- 56948
Transcript NameFunction/comments
g8410.t1 hypothetical protein PHYSODRAFT_517537
g8411.t1 hypothetical protein PHYSODRAFT_258801

Sequence
1558 bases(100 bases per row)
GGCTTCACGTCGCAGCTCCGCGGCGCCGCTGCACATCCACCAGACCTGTCCACGCAGCTTCGGCGGCACGCCGGCTTTTAGCAGGGCGTCGAACTGACGC
GCATGCAGCATGAGCTCCGCCGCCGTCGCGAACGTGGACAGGGTCATCTTGACCGTCTTCGGCGGTGTCTTCTCCTTCTGTTGCTGCTCCACGAAGCGCT
TCTGGTTCTCCTTCCACTTCTGACACACGCGCTCCTGCGCCCAATCACGCGCCGCGAAGCGCTCGCTCCATTTGCGCAGGCGGAACTTGTACAGATCCTC
GGCTGTGTCCAGCTCGACCGGCGTCTGCTGCACGAGACACTGTAGCACTTGGCGCTCGCAGCGACAGGCCAACGCCAGACGCGCGTCGGCCGCATCCGCA
TCCGCCTCCTGTACGACCAGTGCCGCCGTGGTCAGGCGGAAGCGGCGCGTGGGGCGGAAGCACGCCAGTTGGCACCCGTGCACACGCGGCGTCGAGGCGT
CGGTGTGCGCCATCCTCGTCTCGGTTTTATTGTGGGACGTTCTGATACCGGAAGAAGCCCTGCGAAAACGAATGCCAACTGCTCGTGGATTGGATGAAAA
GCGACGACGAACCGTCGCAGGAACTGTACCGGAAAACCGGTACATCCAGGAGTGATGGTTGTGTTCTTCAAAACGGGATCGCGAGCCATACCGACTTGAG
CATGTTGCGGCTATCAACGCTGGCTGCGCGCGCTTCCAAGCCGCTCTCGCGCTCCCTGCACGCCTCCTCGCCCTCCGCCTTCCTCGTGCGCTCGCTGGAC
GATGTGCGCAAGAGCCACCGCGTCGTCACCAGCGACGACGGCGCCCTCGAGACGCGGTACGTACGCCCCCTCTTTTTTCTTGCACCATAAACTATTATTT
TCTTATCTATATGACGTAATTGCATGCCCACGTTGAAGTCGCTACCTGGTGCGAAATGACGAATGCGGCTTCTCGGTGCAGCAGGAGGTGCTGAAGAAGG
GCATCCCTGTGCGTCTCGAGTTCCAGAACCACGTGTACGCGCTGCTGGTCACGCACGGTAGCGGCCGCGTGCGGCTACTTGACGTGGGCGAGGGCCAGGG
CCAGTACCAGGCCGTGCAGGAAGGCTCGCTCGTGGCGCTCAACGCCGCCGAAGCCGTGGAGATGGAGGCCGAATCGGACGAGCTGCACGCCGTGAGCGTC
ATGAACCCGCCGCTCTTTGGCGTCGAGAAGAGGAACCCGACGACGGGCGTGTTCCCAGCTGTGGACGCGGACGGAGAGGAGCTCGAGAGCTTTGGCCTGG
CCGAGGCGGAGCGCCTGTTCTCCGCCCCCGAGTCACTCCAGGGCGGCAGCGCCCCCATGAAGGACGACCCGCTGTTCTAAGGAAATAGCAGAAAAAATGA
CGTTGACTCGACACTTATGAGGACAATACAGGTGAAAATGCTGCCAGATGCAAGTACCAGGGTCCTGCTTGGTGCGGTACGTTGAATTAGGCTTGATTTT
TGCTTTGTTGTGGTGTCTTCAGAGCTGTGAAGGTTTTGAGAGAGACTGTCGACGTTGT