Description :
From Genome Similarity Track
Location :
Scaffold_194:5537- 7706
Sequence
2169 bases(100 bases per row)
TCCACCCCCACTTGAGATCGAACCGTCGAGCATTGGAGGGAGGCGGGGGTGTTGGAGATGGACCGCATAATGCGGCGAGAAGCCAGTGGATGCCTGAACT
GAGGCTTTGTAAGCGAAAACCGCATGCTGTAACGTGGCAGCCCACGAGGAACCGGTAGAAACGGAGTAGCTCCGAAGGATATCTTCGAGGACGTGGTTGG
CACGTTCCGTTTGGCCGTCGGACTCGGGGTGGTCCGAAGTCGACATATCGAGGGAGTGTCGCATAGGGCGAAAAGGGTGGACCAAAACTTCGCCGTGAAC
CGCGGGTCGCGGTCCGAAACGATGGAGGGAGGAAGGCCGAAGCGACAGAAATCGTGGTCGAAAAAGAAGAGAGCTGCGTCCGCGCCGCTCAGCGTGTCCC
GGACGGGGACGGCAATAACGTACTTCGACGCTCGGTCGACACAAACCAAAAGCCGGTGTTGCCGCGGGCGTCGCGCGGCAGGCCAAACATGAAATCCATG
CTGACGGACGACCAAAGTTCGTCGGGAATAGGCAGAGGTTGGAGCGGTACCCGAAAGGAGGCGGTGATGTTAGTGCGCTGGCAAGCGTCGCAATGAGCGA
CGTAGCGCACAACGGATTTGTACATGCGGGGCCACCAGTATGAACGCGCCAGGACCGCGTACATTTTGTCGCGGCCGAAATGGCCGCCGCTGGGGGAGTC
ATGGTAAGATCGAAGGAGAGTGAGGCGCAGCTGCGCGTCACAGGGCACAACAATGCGCGGCGGCGAGTCCGCGGTGGGTTGAAACATCAAAAGCCCATCG
GCGAGGGCGAAGCGATGTAAGGCCGACGAAGCGCGGCGGGGTTTGGGGGAAACGGTCGGTGAGCGCCGCCAGGCGCGACGAGCAGTCAGCGTCAACGGGG
TATGCCGCACGAATTCGATCGTGACGTCCCGACGTTAAAAGACCGAACGTGGTCAATTCGAGATCAGGACGCCGAGATAGGGCGTCGGCCAGGATGTTCT
CCTTCCCGGGCTTGTACTGAGCCGAAAATGTGAAGAACGAAATCCACATGCGCTGCGAAAGGTGCGGTGTGTTCGTCGCCGTGCGTAAGGACGCATGATC
GGTGTAAACCACGAAGGGTTTACCGCCGAGGAGGTAGATGCGGAATTTGGTTAGGGTGTACTTCATGGAGAGAAGTTCCAAGTCGTGGACTGGGTACGCC
CGCTCAGCCGCGTGAAGTTGGCGGCTTTGGTAGGAAACCGGACGAGGGCTACCGGAGGCGTCGAGCTGCATCAGGCAGCAGCCAATTGCAAACTGCGAGG
CGTCGCAGACGGCGGAGAAAGGTTTGTCAAAGTCCGGGAGCGCCATGATCGTTGAAGGTTGGTTTTGAGGCCGTCGAAAGCCTCCTGACAAGCGGAGTCC
CAAACCCAAGGGGCGTCCTTGAGGAGAAGCCGAAACAACGGCTGGGCCATGTCCGCAAAGTTTTGCGAGTATTTGTGCAGGTACGTTGCAAGGCCCAGCC
AGCGACGAAGATCCTTGACGGAAGAGGGAATAGGCCACTCCGAAATGGCCTTGATCTTTTCGGGATCAGCCCGACATCCGTTCACCCACACCAAATCTCC
CAGGACCGGGATTTCGTCTACGCCAAACATGCATTTGGCGAGGTTGGCGTAGAGTCCGTTGGCACGGAGGACTTCAAGCACCTTGCGGAGGTGGCCGCGG
TGAACGTTAAGATCAGACTGCGCGGAGGAAGCGCAACTGTGAACGTAAATGTCGTCGAAGTACTACGGGGCGAAGTCGCGAAACGCGCGGAATTTCGCGG
TAACCATGCGGTAGAACGTCGCCGGGGCGTTGGATAGACCCTGTGGGATGACCAGCCACTCCCATAACATGCCACTCGGCGTAGAAACCGCCGTTTTCGT
CACATAGACGCATCCAGATCTGGTAAAAGCCACCGCGAAGGTTGATGGTGGAGAAAATGGTACATCGACCCATGCCATCGATGATGACGTCTTTGCGAGG
AATCGGCGTCTGAGCCGGAATCGTGGATGCGTTCAATTCCCACCGGGCTTCTTCACACAGAAGGTCGGGCTGCTGTGAGGGGAAATGCTCTTGCGGACGT
GACCCGCCGCCTTGCGGGCCGCGAAGAATGCGTCGATGGCATCGACTTGGTCGCGAGGAAGCGACCATT