Description :
From Genome Similarity Track
Location :
Scaffold_127:55366- 56618
Transcript NameFunction/comments
Phyci_96469Hypothetical protein

Sequence
1252 bases(100 bases per row)
CGGCGCGGACTGGTGAACATGGGGAACACGTGCTTCATGAGCTCGGTGCTGCAGGCCTTGGCGCACAACCCCATGCTGCAGCACTATTTCTTCGTGGCGA
GGAGTCATGACACGACGATCTGCCAGCAGCAGAGGCAGCGACTGTTGCAGAAGAAGCAGGAGCAATTCAAGGTTGAGAAGCAGAAAGAGCGTGGTGATGA
GGATGACGACAACGGCGACAGTGAGAAGGACACCAAGCGCGGCCCAGATCCTGCGATCACGGTGTGTCTGGGGTGCGAGCTCGCGGCCTTCATGGCACTG
CTGGTACCTCCTACTGCACGTTTACCGGGTAAAACGTTGGTGGCTTCCCCCATCGCTCCACAAGGGATACTGGAGGCGATGTGGAACGCGTTCCCGTCGT
TTATTGGTACAGCTCAGCATGACGCACATGAGCTGTTGATCGCGTTGCTGGGTGGACTGCACTCGCACACGCACCCTCGCGTGTTTGTTCACGGTGGTGC
ATCTCCAAGATTTACCCCACGCGGACACAGTTTGTGTGACTGTGCTGTGCATCAGCATTTCTCTGGTGTATTGCGATCTGAATTGGCGTGCGGGGGCTGC
GGGTCAGCCTCGCACAAATTCGATCCGTTCCTGGATGTCTCTTTATCCCTCGACGATGGAAAGAGCAAAAGTGGCAAGGATGAAAAACGAGAAGGAGGAG
TCAAGAAGGGGTCGTCGGATTTGTCGACGATAACTCTCGAATCGCTTTTGCGCGAATTTGCCGCTAAAGAGGAACTACGTGGGGCGAATCAAGTCTACTG
CCTGCGTTGCTCAAAGTACCAAAACAACTACAAGAGCCTGAACTTGCACACGCTGCCTAACGTGCTAGTGTTCCATATCCGTCGTCTCGACTTCTACCGT
CAACAGAAGCTCATGCAGATTGTACAATTTCCCCTGGTAGGACTCAACATGAGACCATTTACGTCCGTCGGTATCGATGAAGCCAGCGAACGCAAGAAAC
GAGACAATAAAGGAGCAGTAGCAGGACGTGTAGACGGTGATCAAAACGAATTCGTGTACGACCTCGCCGCCGTTGTGAACCACCACGGGGAGTCAGTGAA
CGGGGGTCATTACACTTCCTACGTGCGTGACGAACTTTCCAGCGCGCAAAGTTCCAACTCCAAGCAACAACAGTGGGTCCTCTTCGACGACGTCGAAGTT
AAAATCGTGCCAGCCGACGAAGTCGAAAAGTCTCAAGCGTACGTGCTCTTCT