Description :
From Genome Similarity Track
Location :
contig_73:55351- 56854
Transcript NameFunction/comments
g9927.t1hypothetical protein PHYSODRAFT_335672
g9928.t1conserved hypothetical protein

Sequence
1503 bases(100 bases per row)
GTTAATGGTCGCTCCGGACGGAATCACGGCGCACACACAAGCGAGGCAAAACGTTTCCGTGCATGGTCCAGACGTTAAGCCAGCAGCGGTACCTCCATTG
GCGTGATAATGAGCGCAGAAGATCGGCTTAGTCACGCGGCACGTGCGGCAACACGGCTTCCAGCAACCACGACAACTGCGAGGAGCGTCCCAGAAGAAAA
GCGCTCGAGCGCACACCCCACAGCGCTGTCTGGAGCTGGACTGCTCTGCGATGGCTTGCTTTTGGCCAACCAGCAGCAGTGACAGGTTCTTGGCTTGGCC
ACTCTGTACAGTATTGGCCATGGACGTGAGCCATTCAGCGATGCAATTGTCGCCCAGCAGCGGCGGCAAGCGACCGCTTGGGTTAAAGAGACCGTGCGCG
AACATGGCCACTCGGTCGTCACCCACGCTCTTAAACACGATCGCCAGCGAGATAAACCCGCGCACGAAGGTCCCAGAACCGAAACCCGCAGAGCTGGCGC
TGCGAGTGCGTCCTGGGTGGGCTGGCGCGGCTGGAGGCCACGTTGCTCCTGTCTGCGCGTACGTGTCGAACGTCGAAACTTGCGCCGAGATCTCATCAGC
CAGCGGGTCAATGGAGTGCAGCACCATGTAACCCACATCTTCTCCCAGGTCGTTCTTGAACGTGTCCATCTTCTTGAAGCACAGGAAGTCCCTATGTCTG
CAAATACCCAGCCCCGGGATCTTGAGCGCCATCCACACAATGCCCGAGAAACGGAACGGGTTAGCCTCAGAGCTGCTCTTGTCCACTTGCAGCACGCGGG
CGTCCAGCGACCGCGGACTCAGCAGCATCTGCAACACCCGCGCGGTCCTCGTCGAGTCCGCGTACAGGCCGTTCATGACGTCCCCTAGTGAGCCGTGTAC
TGTGCCAATAGCCTGCACTGTGGATGTGCGTTCCTGCCGCGTCTTCAAGCGATACACGCGGATGTCGCTGCTCTCTCGCAGTAATTTCCATTGCCGCGTT
TCCACGGCCGTCATTCGGGCGGGAGAGCCCGTTCTGGGCAGCTCCGGACCTGTTGCACTCAACGGACAGCGGCTCAGCCGCGCAGGCGCGAGCGGCGTTC
GCGCTCCTGTCGCTCCCGGAAGAGCCGCAGCGTCGCGTCCAGACGCTTGTTGCTCTGCTGGTGGTAGCGCCGCAGTCGCGCGGCCGTGACATCGTTGAGC
GAGCGGTGCAGCAGCGCGGTGGGCTCGTCGTCCATTTCCAGCGCGGATGCTGAGACGAGCCCCGCTGCTGTGGGAGGCCGGCAGACGTCCGCCATGAAGC
CCGGCGAGTACGCGGTGCGGAGCAAATTCGGTTGTGAGAGCTGCGTCCGCTCGCCGTGGCGAACTGACTTGGTTTCAGTATGCCGCGACGAGAGTACCTT
TGTCGTTTGCGTTACGTATCGCAGGCCGCGATAACGGCAGCTGAGCCCAAAGCGTATCTTTTGCTTCAGCTCGCAAATGCGTTCGTCTGCAATTTGCGGA
AGA