Description :
From Genome Similarity Track
Location :
Scaffold_12:553503- 557618
Transcript NameFunction/comments
Sapdi_VS20SDRG_04874hypothetical protein

Sequence
4115 bases(100 bases per row)
GAGTGGACGTGTCCCAGGGCCGCCTTGATGTACGCTGCCGCATTGTCCCGGTTCACGAGCGCGCCCGCGCCGCTGGCTTCGTACCGAAAGATCGCCTCTC
CGGGCAGCGACAACAGCAGCACATCGGCGTCCTTGGCGCCCGAAATGCGCACGTCGGTCGACGTAATATCGCAGAAGACGTCGCCGTTGACGTAGATAGC
CGTGCGCGTGTCGAGCTTGCCACAGACAACGTCGAACGTCACGTCGTCGGCAGGGTTGAGGCGCCAGCGGACACCCGACGCGCGCAAGCTCACGTTTGCA
AGCAGAGCGTCCGAGACAAGGACGGGGCTCAGTGGCCACGGTACGAGAAAGCACAGGAGAGCTTCTTTCAGTACGTGGTAGTTCCAATAGACGTCCAGCG
TCGGGAGCTCGAGCGTCAAGATCGGTGGCGCGCCGGCCGCCACGACGCACGTCCACGTCGCCACGTCTGGCATCGCGAGAAGCGTTGTTGTGACGCGTTC
ATCAAACGTATACGACCGGTGCGTCGTCGTCGCCACAGCCTCTTTGCCTAAGAGTTGCTCGATGTGTCCCGTGAGCGTCAGCGCGCCCGTCGCCTCGCGG
GTCGCATCCACTTTGACGTTGGCGGCCTCCAGCTGCAGGCCGGACCGGAGCACTTCATTGCCGACGACACGCAGCTGCACCGCAGACGTCTCCACATGCA
CCTCGAGCGGGGTTGGGAGACCACGGACTTTGGTCGATGCCACCGAGGTCGACGGTGGCGCCAAGTACATGCCCAAATGCACAAGCGACCGGACCTGACC
TTCGAGGACGTTGGCGAGCAGCGGGCCAAGCACCACGTTGTAGCTCCAGATAGCCGACGCCTTGCATGTGCCCTGCACCGCGCACGGAAACCGCTTGAAA
AGCCGGCAGTTGTGGGCCAGCGTCGCATCGTCAGCGAGCAAATGCAACTGGCCCACAGGCACCAAGAGCAAATCGACGGCCTCGAGCGACGACGTGAACG
CTTGGTGCACGTCGTCCGTGCGAAAGCTGCCGCCCGTCATGTGCAACAGCAAGAAGGCATCGTCGGCGCCGGCGACCGCGACTTGAACTTGCGAGACGTG
TACGACAACGTGTAGAGGTACGAGCGTCGTATCGTCGTCGTCGTCGTTGAAGGCTGCCGTCGTTTTGGACGAAGCGGCTTTCTTGTCAAGGTCGGGTGTG
ATGTATTTTGTGATCTTGTCCATGGCCTTCTTGTGGTACAGAAGGCGCGCCGGGTCGATCGCAACAGTGATGCTCGACAGCGTTGGTTGGGCGTCGTACT
TGAGCTGAATCAAAGGCGCTTTGGACCGCAAGTGCGGGAGTGGCCCGAAAATGACGGCAAAGGGCGAGTCGGCGGACACCGTCGCATCGAGGAGCTCCAC
GTGCCCGACAGAAAACTCAACATTGCACTCTTGGCGTCCGTGGCCGACATGCAGATGGTGCTGCAGCGAGAACGCGATCGCACTCATATCAAAGCGGACA
AACTCTTTTCGAATGACTTGCTTGGCGTCGGTCAGGCTCTCTTTGGCGACCGCGACTTGGACGCGGTCCATGTTGAAGTCGAGGCCTAAGAGAATGCCGG
GGGACTTGGTCGTTTTGGGCGATGTCACGGATGCTGTTGATGGCGCGGGCGCCACGGGCAGCGCGTCGTCTTCAAAGAACCACGAGCCCACGTGCTCGTA
CACGAGCTGGCGCTCAATGGGCTCGAGCGTCACTTGCAGCGCCGAGGTCGGTGTCACTGGGCCTGATGACGTTGGCGACGGCGGCACGGGCGGTGGCTCG
GCCTTGCGCGGCGAGAAGAGCGAGAATTTGCTACTTGTCGTCGGCGGCGTCGTGGCTGCGTGGGTCGGCGACGGCGCCGGTGACTTTTTCAAGAGGCTCC
ACTTGGCCGTCTTGGTCGATTCCTTGATGTGTTTACGGCGCGTCGTCTCCATGGCGACCTCTTCTTTGGCGCAGAGACGGAAGAAGACGAGCGTCTCGGC
CGTCAAGCGCGGATCGTCCTCCATCGCCTGGAGCTGCACCCCTTCGGCGGGCTCGAGCGGTGGCTTCCATGGCGCGAGGTTGAGCGACCGCGTGTACAAC
GGAATGTACGCGGTGCGCATCTTGACGAGAAAGACGTATTGGCGCCACGACGGCGGCAGCGCGGTGGCTGGTAGCAGCAGCCGACGCGTCGCGTTGATAG
CGTACTGCCACCACACGCGGGGGTTGCCGCGCACGCTGACGCTCGGGCGCTGCTTGCGACACTCGCTGCGCTTGAGGTACGTTTCGTGGGCGCTGAAGAA
ATGCAGGACGTTGGTGATGTCCTTGCACTGGGACGGCGCGACAGCGACCACGAGGTCGGAGGCCGCGACGCGCACGCGGTAGCGCGGGATAAAGTTGTAG
GACGACGCGTCGTTGTTCTCGGTGATCTTCGCGGTCGTGCTGAACGGCTCGACGAGGTACGTCATTTGCGTGCCGCCCGTGGCTTTGGCGAGGTCCCAGT
AGACGTAGCAGCTCTTGAGCTCGACGAGCTTGTGCACGAACGGCGTGTGCGAGCTCGACCGATCGAGGAACGCGACGTGGCCGTTTGCATTGGTCGTTGC
GACCTTGAGCTCGTCGATCGAGATGCCAAAGCTCAGCGGATGCGACGAGACCTCCATCGACGTGTCTTCGTACCGTACGTGGATGCGCTTGAGCTCAAAC
GAGAGGTTTTCGAGCACCGTGTTCATGATCTTGTCCTTGTACTTCCAGCTCGAGCTCTGCTTGGTCTTGGTCTCTGTCTTATCACGCGGACTCGTGGGCG
TTGCCGAGTCCGACTTGCTCGCGCAGAGGAGCTCGCGCATGCGCAGCTCGTGCTGCTTGGCCCAGCGGAGGCGCTCGCTCTGCGTCGCCGCGTTGGCGCC
TTCGTGGCACGGCCCGAGCACGAGGTAGAGGTCCTCCAAGACGACATGCACCGACTCCTTGGAGAGGCGCTTCCATGGCACCTTGATGAAGAGGTTGCCG
AGCCGCCCTTCCTTGAGCACGAAGGGCAGGCGCAGCGCGTCGAGGGCCTCGCGCTTGAACTTGAGGTTGGAGAAGCAGATCTTGCCGCCGAAGAGCGCCA
CGCGCATGCCCTCCTTGTCGAAGCCATCGAGCCACTCGGAGAAGTAGTCGACGACGAGCCCCTCGATGTAGCGCTCGAACATGCTCTTCCCGACTAACCG
CTATGAAACGGATCCACATTGTAGCCAATCACGATGCGCCGAGAGCGACGATTGGTCAAAATGTGACAAACGACGACGTGGATCTTCGGGGACAACCTGT
GCATTGCACGAGTTACGGATGACGGGATGCCACACCATACAGTCTATGACTAGTAGAGTTATGTTTACGAGTGATTCGTGCAAGCTTAGTTTGTTGGCTC
CATTCTCGGTCATCAAGCCGCACGGCCAGCGTCGTTCCCAAGGGTGCTCGACGAAGAAGCCTCGGGGCGATGTACTGGTGCGTTGTAGGCCAAGAAGGCG
ACGCAAAGCTAATGAATTAGTCTTCGCTTCGCGCATCGAGAACCAAAGCTCTCAATAGTTTGGCTTCAGGTCGGCTGAGGAAAGGGGGTCTTTGGAATGG
ATGGCATCAGTCGTTTAGGATGCTTCCTTGGGTGGTGCGAAGGGTTGGCGCACTTCGATATCAGAGGGATCAAAGTACAACAACAATACCCTTGGCTTGG
AGTACCTCCGACGATGATGGCTCCAGTAGCAAAGCCCATTATGGAAGCGTGGTGGAAGGTCATACGACGACACAGGCACTGCCGTCACCAGTATCACGAT
GGCTAGGATTGCGTCCAAAACACCAAGTAATCTGAAGAAAGCCCGAGAAGCAAAGTGTCGAGGGAGGATTTGCGGTCGCTTGATTGGGACCTATCATCCA
CGCTGGCGTGCGATGGAGCAAGCAGAACGAGGAGCACACGCCAATATATAACTCCATCCAACGCCGATACAGTCGACGCAACGCAGCCATTCGATTCGAT
TATGCTAGTGTTCCAGCGTCGATGACCGCGAAAGCAAGCGCTGAATCATAATGCACAGATGAATTTGCGACATGCAACGTGAGGATCCTCTGCATGATTG
CACTGGGAAGAGCGA