Description :
From Genome Similarity Track
Location :
Scaffold_1138:5535- 8118
Transcript NameFunction/comments
g17510.t1hypothetical protein

Sequence
2583 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGT
AACACCTTCCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATACCAGTTTTAGGAGGAGACC
CCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTCCCTTTGTCTTAGTTTAAGTATACTTGCGGATACAAGTATACTGAACTTA
AGTTAAATACATCTACGCTTCCTCCTACACGTGCGCACACGTATAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCC
GTCCAACGACCGACTAACACGTTCGTATGGAATACGAACACGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGC
AACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAATCATTGGGGAAGCGGCGGTAGCAACG
ATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAATCGCTGCTCGAACTTCGGTGTCGCCAT
CGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGC
CATCGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTC
ACGGATCCTGCTTTAGCACGTACGAGGATTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTTCCTCGA
TCTGCAACAGGGCTAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTC
GTCACGTTCGTGAAAGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCATTGCAAG
AAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCGCGGCCGATACCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACCAATGGACCT
CTCGAGTGCGACAGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCACA
GCACCTGTGCACGCGGCGAAGAGGCGTCGTGGCGATACTGGGTATCGTCACGGGCTAACAAAAAACTAGAGGGACCAGCAGGCGCGGGGCGCCCTGCTGG
TGATGCGGTCGAGTGTGTCGACATCGGACACGCTGCATTGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAAAGCAAGATGACAAGCCGA
ACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTCGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCC
AAGGCTTGACTTCGAGGAGGTGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTAC
GCTTCTCTTACCAAGAGAAGAAGTTCGTCGACGAGCTTATCGTCCTCGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCA
TGATCCGGTGATCGACTGGATGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACAT
GCACCACGTGGTGCATGCGGCCCTCCACCAGAGACAGCGCGGAATGCGGCTGTCTCCGGCCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGA
GAAGATGTGAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGACTCGAAGCGTCCGGAGCGACGCGGTAGTGTCGACAGCTAATGTCGACAC
ACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTCGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGT
CCCGCACCGGAGATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCAGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAGAAC
CCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCACACGAGAAGTGAACGGCGCAAGCGAGA
AAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGGGTTGGAGACGACCGTCG