Description :
From Genome Similarity Track
Location :
Scaffold_1216:5535- 6694
Transcript NameFunction/comments
Phyta_totarag12426hypothetical protein

Sequence
1159 bases(100 bases per row)
AGCAAATCCCGTCCAGTGTCGCTAAACACTCTGGTGATCGCCTCCGGCCTGCATGACGAGGAAATGAGACCGGACTATTGCGCCCTGGTTGAACTCGTAG
AGAATCGCACCAAAACTTAACTGCGACAGGGGGAGCATCTCGCGTTCTTCATACCCCTTTCACTTGATGAGGTACTCGCGGACATATTTGGACGTGCGTG
TACGCTTGGTCCAGTGAAGGTCCAGaatcttctccacgtcgtacTCATCGTTCTGGTGATCGGCTTCACAGCTGTCCTCCACTTCATCATACTTATGCCC
GACGACAGCACAAACTGCCCACTGGTTGGCATGAAGATAATCGCAAACGGCTTTGTCCGGTCGGAGCGACGGATTAATGGCGTCGACACAATCTTTCGCT
TGCGAATCTCAAACGCTTCCTTGGCTCTGGACAAATCCCTTCCTGATCGCATTTGTTcttccttgagctcgtacaGGATTGCAGCCACAACTGGGAAGTC
TTCAATAAACCAATGATAGTAGGTGAGACTTACTAGAAGAGACTGTACCCCTTTCAGAGCCGATGGAAATGGAACGTCCTGGACGCCTTTCATTATCTTT
GGTATGGCTCTGATCCCTTCCCCACATATCTCATGAGAAAGGTACGGGATTGACAGTTTCCAAACCCGCTTTTGGGGAGGCTCACCGAGATATTCCAGTA
ACCCAGTCTGAACACCAGTGCATTCAGGTCGTTGCAGAGTTGATTCCAGGTGGGCGCCCCATGAACGATGTCGTCGATATACAAGCTTCGTCCGAGAACC
GGTCACATCTGAGCCTGCGCTAGGATATTCCGCTTGAACACTGTTACCCGATCCGTCAGGGTAGGCACCTTCCGTGCGGACTCTTCTCGTTCGGTTTCGT
TGTGTTCAGACGGGTCTCCATCACGTCTCCATCCACCCATACTTCTTCCTCTCGAGGGGATCGTACGAAACCCCAGATGTAATTTTAGTGACAGCATGGT
AGCATTCTTCAGTCTCAATGGCATGCGCATCCATTGGAAGTGACCAAACGCAGAAATCAAATAAGCACGTTCGGTCATCCGGATGTCCCATAAGCCACTA
GCCATGTATAGACTCATGAACCACATCGCTCTGTCGAAACCGATCAGCAGGTCGTCAAT