Description :
From Genome Similarity Track
Location :
Scaffold_8:553441- 556146
Sequence
2705 bases(100 bases per row)
CCTCCAGATAGAGGTGTCCGTCATAAAAGTGACTTAGTTCCTGGGACGAAATACTGTGTCACACGACAGTGGCCCTTGACTAAGGAGCAATGTGATGTCA
TCGATGACTTCTTCCGTGCTAAGCGCGAGGTAGGAGTGGTACGTGAGAGTAAATCTCCACATTCGACACCAATATTTTTTGTCAAAAAGCCGAACGGCAA
GTGGCGTATTGTGCATGCTTATAACAAGCTTAATGCGGCTACTATTCCGGCACAGACATCCATTCCTCGAAAGGATGTTCTTCAAAACAACATGGTTTTA
CTATGTATAGAGGATTCGACTTGGTTGATAGATATTATCAATTGCTCATGTGAGCGAGTTATATTCCGCTTACAGCAGTGAGCACACCGTGTAGTATGCT
ATGTGAATGGCTGGTGATGGCCCAAGAGCTGTCTAATGCTCCTGCAACATTTAATCTTCTGGTGACGTAACTTTTCCGCCCCCATCGGGATTACGCACAG
ACGTACTTTGATGATATTTTTGTCCATAGTCGTGCCGAAAAAGGTCGGTCAGATGTTGACAACCACATAGGTCATTTTCGAGCCATGCTCGAGTGCATTG
TACGCCAACGCGTCTAAATGCATTTTGGTGCAGAGGAGATTACTTTTATAGGATGTTTCATTGGTAAGAGCGGCCTTAGAGCGGATCCCGCTAAGGTCAA
TGCTACAGTGTAATGGCCGATTCCTAAGAATCAAAAGGACTTGCGTAAGTGGCTTGGCCTTGCCAATTACTTACACAAATACAGTGCAAATTACGCTGAT
ATGGCTCGGCCATTAACTGATCTCCTTAAGAAGAACATCGATTAGCGCTGGGACAACACCCATACTGAAGCATTTCATCAATCAAGGAGAGCCTCCTCCA
TGCTCTCATCTTGGCGTTGCCAAATCCGGAGTACGCTTTTGGTGCTGTCTGCGATGCATTCGACGTTGCCATAGGCAGCGATCTGTTACAAACAGATGCT
GCAGGCTGCGAGCGAGTTATCGCGTTTGAATCACGTCAGCTGAAAGCTGCTAAAAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCTATGAAGTATG
CACTCGTCAAATTCAGAGTCCATCTGCTTGGCTTCAAGCCATTTGTCGTCTATACGTATCATGCGTCATTACGTACGGCGAAACAGTCGCCTCACCTCTC
TCAGAGAATGGCTCAGAGGATTTCCTTCTTTGCGAATATAACTTCGAGGTGAAGTATGAGCCAGGCAAACAAAATGTATTGGCAGATGCCCTCTCCTGCA
TGCCTGATTATGAGCTTGCTCATGTCACGACGTTGTCGTCTCCTCTTGAGAAGTTAATTCGTGTGGCATATCCACGGGATTCTCAATGTGTGGCATTGTT
TCATGCCCTTAGGAGTGAGGGATACAAAGACTTGGACAGTCAATTATCGGCACGATTGCGGGCCATTCTACATCGATATTCCATCGATAATGGCCTTTTT
TGCTATTGCACAGATGTAGCGGATATCGCTCGCATTGTTGTACCTCACGATGAGGATTTAAAGTATCGAATCCTCTTTGAGGCCCACGATACTGCCCTCA
GTGGACATTTGGGCCGGGAAAAGACTTCCGGCTCTGTGAGTCAACACTACTGGTGGACCAAACTCTACAAATGGGTGAGCGCATACGTGCGTACATGCGA
AACGTGCCAGCGGGTCAAACCCTCAGCACATTTGGCTGCGCCTCTCTCCAGTTTACCTGTCCTCACGGTGTGGTGGGAGTCCATCTGTTTAGATTTTTTG
TTTGGTCTTCCCAAAGACTGTGACGGTAATACGGGAATTGTGGTCTTTGTTGACCGTTTAAGCAAGATGGCTCACTTGGCGGCGGTGTCGGATTCCATCG
ATGGCAAAGGTACAGCTATGCTGTTTATCGATCGTGTGTTTTGTCAACACGGGTTTTCGCTAGCAATCATCTTTGATCGTGACCTTCGCTTCACAGGCTA
GTTTTGGACTTCCATCTTCAAGGTGATAGGCACGCGATTGGACGTGTCTACAGCGAATTATACGCAGACGGATGGTCAGACTGAGAGAGTTAATCGCGTC
ATTGGCGACGTTCTTTTTGCAGTGTTTGTGCTGAGTCGCCTAAGACTTGGAGCTCGATGCTCCCTGTCATTGAGTTTGCGTTGAACAACGCCGTTCATGA
CTCGACCGGCTTTGCCCCCTTCTATGTGAATACCCTCCACACCCCGCGTTCCGCTCACGTTACTACTTCATGGATCCTGGTCTTGGTGGGGGAGAGTCTG
TTGACAAGCTTGATGAAATCAGCTCTACCACGACGCAGAAACAAGTTAGGGAGTTTCTTGCGACGCGCTTTAGTGTCTTACGACATGTGCGTGAAGCAAT
GGCTGGAAGCCAAGACAAACAAAAAGAACAAGCTGATGCTTAAGGCAGAGGATGTATTGATTCTTATGAAGTTGGAGACCAAGTCTTATTTAAATGCTAA
AACCTACCTACAAATGTAGTGTCTGCGGTCTTCAAGACGAAATTGCGTCCGCGCTTCAGTGGGCCGTTTACGGTCATAGCGAAGGAAGTCTTTGCCTATA
CACTAAATCTCCCGCGCAAGTTGCGCACACACTCAGTGTTTTACGTTGGCTTGCTTAAGCCATATCATGGTCTTTCTCTCGTGTACCAGAAGGCGCATGC
GCCTG