Description :
From Genome Similarity Track
Location :
Scaffold_1:553412- 554640
Sequence
1228 bases(100 bases per row)
acgcttctcccagttgatcaccgggtcatgccgtgcaagccacggcatgcctaacaccaagtcgaacttatcgtctagatccaagacgataagatcttcc
acaaacgtccttcgtttgtacgagaagcgcacacggaccacgcgcttctcggtcctcacggtggcacctgttgccaaccgcacctccaacacgccgcgag
gcgtgtcggcctcttcgaagtccatacttcgaagacttccctgtcgaacaaagttgttcgacgcgcccgagtccaccagggcacgaagagagttaactct
cttcgacataacattcaggatgacaaggtttggcttgtcatcttgcaacttgcagcgagaaaccttctcgctgggggcagcagtcctcatcgtcgcgtgt
ccaagttcgacacgcgagactgcatcaccagtaggacgccccgcgcctactggtccttggcgttttttgaacgcccgcccggatgcacactcgctgtgca
ttcgcgtgcaaagtgaccgatgttactacacttgtaacatcgtaccttgaaccccttacgctgctgttgaccagcagtcgtagcactcgagaggtccatc
ggctccggacctcccgccttcggtacaggacgcgccggcttcggcgcgttcgcatggagtttagcctgacgccggctaaactcctcttgcatcgcaaggc
ttatggcttcctcgagagtattcggatactctcgaaagaggtatgtcttgacgggaccgtctctcagtcccttcatgaacgtgacgaccttggtcgcctc
gtcgaccgggttggccactatgttcgataccaagtatcgagcacgctgggcataggaatgcacgtcatccttgccctgctgcagatcgaggaactccgcc
ctcgatctgaactcgttcttcgggggctcaaacgcgagcttgagctcctccttaaaaccttcatacgtgctgaagcacgtaggatccgagagtcggcgcc
cataggcccaactcctcgcgcgtccgcccaagcatgacatggcgaacgcgaccttcgacatcgggtcgacaatacgtcgagccgcaacggctgtgtcgag
ttcgacaagccaacgaaggagggtctcgtcctccttccccgcataggtactcacgtggagtttcaacgactccacgcgtggcttcggggaagccaccgag
gcagcaacatctcgttgctccttaacaa