Description :
From Genome Similarity Track
Location :
contig_104:55333- 57808
Transcript NameFunction/comments
g13037.t1hypothetical protein
g13038.t1hypothetical protein
g13039.t1XP_008909821.1 hypothetical protein PPTG_14641 [Phytophthora parasitica INRA-310

Sequence
2475 bases(100 bases per row)
GCACCCGAAGCGAGCGATGGCCCTTCATGTGCAGTATGCGAAAACGCAACCTGCGCCGGTCCTGAGCAGGAGTCTCAGGACGCGCCCGACGTGGTCGAGC
ATGGGTTCCCACGTCCCGATGAGCAGTGGTTCTCGGATGAAGACGATGATGACGTGGTCGAGCATGGTTTCCCACGTCCGGATGAGCAGTGGCTCTCCCC
CGAAGAAGAAGATGACGTGGTCGAGCATGGGTTCCCACGTCCGAGCGATGATGTGGTTGAGCGTGGCCTCCCACTTGCGGTCGAGCATGGATTCCCGCGG
GTGGTCGAGCGAGAGCTCCCCGAAGAAGTTGACGCGGCCGAACAACTGGCTCCGCGTCTTGGTGCCGATGTCGAGTTCCGGCACCCCGAGTCTGCTGACG
TGATCGAGCATGGGTTCTCACTGTCAGCTGTGGAAGACTCTCCACGCCCGGTTCGTCGTCGCGGTCGTCGTAAACCGCGACGACCTCGTGCGCCGTCGCG
GGATCCAGTCGAAGCTGAGACCGAGATGATCTCAGTCCTGGTGGGGAATGACGCGGACGAACCTCCGCGTGCGTGCAACGTCGAGGTCGCACGTCCTCCA
TGCGACGCTGCCGAGATCACTCGACTGCCTGGCCTCTCGTGGAAACATTTCCTTCGCGACTTGAAGAAGGGCGAGATCGAACAAGTGTGCATGATCGTCG
CCGAAGACGCCGCATCCATCGCAGCCGTCGAGACCCACGCATCGGACTCAACGTCCGACGCTCGCACACGTCCGAAAGGTGCTGAGCCGAAGAACGCCCG
CGCAGCACGATACGCTGCCCAGTCGTTGCCGGCTCTAGAGGCTGCCGGCAACCCAGTCGCTCCTCTTGTACGCGAGTTCAGCGACATCTTTCCGGACAAG
GTTCCAGCCGCCCTTCCACCCGATCGTGGCGTTCGGCACGAGATCGACCTCGTGCCAGGCGCGAAGTACTGTGTGACGCGGCAGTGGCCGCTTCCCCGAG
ATCAAGTCGAAGCGATCGACGCTTTCTTCGAAGGTCGCCGGCAAGCCGGCCACGTCCGCGAGAGTCTGTCCCCGCATTCCAGCCCGACGTTCTGCGTGAA
GAAAGCCACCGGCGGATGGCGGATCGTCCACGCCTTCAACAAGCTCAACGACGCCACCATCCCGGCGCAGACGCCGATTCCGAGGAAAGACATGGTGCTC
GACACCATGTCCGGCAGCACCAAGTTCAGCGCCATCGACCTGATGGATGGCTTCTACCAGATCTTGATGCGCGAAGCCGACGTGCCGTTGACTGCCGTCA
GCACGCCCAGTGGAATGCTCTGGGAATGGCTCGTGATGCCGCAGGGGCTCAAGAACGCCCCTGCCACCTTCAATCGCATGGTGTCAAATCTGCTCCGGCC
GTTCCGCGACTTTGCGCCCAGCTACTTCGACGACATCTTCATTCACAGTCGTGCCGCGGGCGGCATGACGGACGTCGAGATGCACCTTCAACACCTGAGG
CAGGTGTTCGAAGTGATGAGGGAGAACAAGCTGTATGCCAACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGATCCCAGTGCTCGGGAGCTACGTCAGCA
CGGAAGGTGTCCGTGCTGACCCGGAGAAGATCGAAGCCATCTGCGCTTGGCCCGCTCCTCAGGATCAGAAGCAGCTCCGGCAGTGGCTTGGTCTCGCGAC
GTACCTCCACCACTACTCGAAGAACTTCGCGGCAATGATCCGCGTGGTCGTGGCGTCCTGAGCACCAGTCGGCTTTTGACGCGGTGAAGACGAGCTTGTC
CACCGCGCCCGTACTCATGCTTCCAGACCACTCGAAGCCCTTCCATGTCGTGTGCGACGCGAGCGACTTCGCGATCGGCTGCGCCTTGATGCAGTTCGAT
GACGAAGGGCGCGAGCGGGTCATCAGTTACCAGTCGCGCCAGCTGAAGCCGGCAGAGCGGAATTATCCGGTCCATGATAAGGAGCTGCTGGCCATGCGGT
ACGCCCTCATCAAGTTCCGCGTATATCTCCTCGGCGAGCAGACCTTCGCGATCTACACCGACCACGCGTCGTTGAGAACAGCGACGAAGAGCCCTCACTT
GTCCCAGCGCATGGCGCGCTGGCTCTCGCTATTCTCCGAGTACAACTTCGTCGTCCACTACAAGCCGGGCAAGGCCAACATCCTCGCCGACGCGCTCTCG
CGTCGGCCAGACTACGTGCAGTCGGTCGACACGCAGTTGGCGACGAGGATGACGACGAGTGCGCTGTGTGTGTTGCTGAAGAGGTCGCTGCAGTGGAAGT
CGCAGCGACTACTCCACTCCGAGACCTGATATCGGCCGCGTACGAGGCGGACGCGGCGTGCTCCGAGATGATCAAGTACTTGGGAGACCCGTCCGACACG
GCGCGGCGCCGATTGTCCGCACGGAGCCGTGCCCGCATTGATCGATACCAACTGGAAGGAGGCCTGCTGACATAC