Description :
From Genome Similarity Track
Location :
Scaffold_154:5532- 6954
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_152433-ketoacyl-CoA thiolase, mitochondrial
Sappa_CBS223.65SPRG_15245Hypothetical protein

Sequence
1422 bases(100 bases per row)
TCTCGTGCGTCAAGGCGCTCGGCGTCGACCCGGAGAAGGGCAACGTCAACGGCGGTGCTATCGCGCTCGGCCATCCGCTCGGCGCGTCCGGCTCGCGCAT
CATGGCGCACCTCACGCACGCCCTTCCTCGCACGGGCACCAAGTACGGCATTGGCGCGGCCTGCATTGGCGGCGGCCAGGGCATTGCCATCATCTTGGAA
AACGTCCAGTAAATCCATGTCATGTCTCGTAGTATACTCTTCTCTTGTTTGATGAGCAGCGACATGGACAGAGCATATAGCGCGATGTGGGATCGGCTGG
CTTGGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNACGATTGAGGTATAGTATAGTATGCACACAGGCTTGTCACGAAGGGCGTTGAGCGACGCAATCAGTGAAATGTGTGGCTTCTCGCGCCGTCA
GCACTCGTCGATCACGAGGTCAGTGACAGATGCAACTCGCAGAGAGTTGGACACGACTGTGTCCACCAAGTGCGCGTTTGGTATCGGTCGCGCCTCCGTG
CACGCACTCGACAGTATGTGGTGCAGCGGCCATTCACAGACGCTCGAATGCCGTTGCGGCCGTAGAGGGATTGGAGCTGCGCTGCGCCCAGTAAAGGCGC
GTGGACCACCTCGACCGACCCTCCGATGCTGCTGCCAGGTAGGATTCGTGCTGAAGTCAAACGCATCGCAAAAGGACGTTTGAGACGTGATCGCGGCAAG
GACGGATGGTGTCGAGCCCAAAGATTCCGTGCTGTTGTAGTATAGAACCTTACCGTGCCACAACGGCGAAGTGCTGGTGACGAGGTGGCGAGATGCATCG
AGATTCGCCGATGGTGGCTCAGTCCGCAAGATCACGGTGCAGCGCCAATACATGTACAACGCTGGATACCGCATTCAGGACGCTAGCCATCGACGACACA
GTCATCTTTTCGAGAGCACAAGCCCACACTTCGACGTGGTCGGGGCGTCGTGAGCTGGCGTCCTGTCTGGCAGCTGTAGTTGCAATCTTCTGCCACCGGG
TTTTCTCCGGCAAGTCGGTTACAACGCGTATTTTTCGCCAGAAGAAAATGCGCTCACTGCCACTCCTTTGTTTTCTATGTCGCGTATGAAAACCAGTCTA
CGGGCCGATCCAGTACATACAAGAACCAAGTGTCATCACATGTCGCAGCCTTAAACTCAAGTGGGTTCCGTTTCCGTTCGAGTTGACATCCATCCAGGCA
AGCCGGATGACCAACCACGGTACGTGCGAGGATGGCAGGTCGTCGGGCGCTCATGCTCGCCATGCAGGAGACAAAGCGGCGCCAGCCGTGTGGTGGCACG
CGCCGGTCATCGACTTTGTCGC