Description :
From Genome Similarity Track
Location :
Scaffold_517:5532- 6908
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_517-abinit-gene-0.11ATP-binding Cassette (ABC) Superfamily

Sequence
1376 bases(100 bases per row)
CTTGCGTTTCATGCCGCCCGATAGTGCGTGGGCCTGTACGTCCCGCTTCTCAGTGAGCCCAACGTCCCGGATCATGCGGTCGACACTGTCGGCGCCGCCT
TGCGGGACCGAGTGGTCACGCTTGACGCGTGCGTAGAACTGCAAGTGCTCGGCGACCGTGAGTTCCGGGTACACGACGCTAAATTGCGGACAGTAACCGA
GCGACTGGCGGATCGTTTCCATGCCGCCGTCCAGAATGGAGACGCCACGGATGCGCGCGTCGCCGGACGTGGGCGGCGTCATGCCCGTGAGCATGGCCAT
GAGCGTCGTCTTGCCGGCGCCGTTATGGCCCAGGAGACATGTGACTTGGCCTTCGTACAGTGACAAGTTGAGCCCATGGACGGCGACCTTGGTGCCGCCA
GGGACGGTAAAGACTTTGCGCAGGCGGGAGATGACGATCGCGCGGTCGTCCTGTTCCTGCTGCTTGAGTTCCATGGGCACGGGCTCCTCTCGACTGTCGC
TTGGCATCGCCAGGGGCACCGCCACGCTCTTCTCACCACTCACATGGTGGCGCGGTCGACGACCGCGGCGCCAGTACGCCGGTGAAAAAAGAAAGTACCA
TCGCTCGGTTACGCCATACTCCCTGGGCATGACCTTTTCCACGTACCAGGCGAGCGCCATGTACAGGAAAAAGTCGAGCAGCTGCATGTACACTGCCGCC
ATGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGCCGCCAATACTATCGTGGGCGTTGGCGACTGTGAGCCCCACGCCA
ATGGACTCGAGCTGCGCGACGATGGCGACCCCTTGCGAAAGCGCGACGGGTGACAGCACACAGCTCAGCGTGCGCGCGGCTTCCGTGGAGCTCTCGGTGA
ACGAAAACGACACGAAAAACATGAGAAAGAAGAGTCCCATGCCCACGAAGGAGCCGGCGCGCGCGCGGCTAAAGAGCGTCGACACGAGCACGCCAAAGCC
AAAGCTGCTGAGCGCAAACGTGAGGAAGAAGACAAAGAGGAGCATGCCACTCGACTGCGTGAACAGCAAGATCGTCGCACCGAGCGTCTGCAGGAGCGAC
GCCACGAAGAAGAGGCCTCCGTACGTGACGAGCCATGTGCCGATGATCTGCTCGTCGTGGATGCCCACGATCTTCATGAACTCGCGTGATCGCGTTTCCT
TCTCCATTAGCAATGCGACAATCACGCGCGAGACGCCGTAGAGATACGACAGGATAAACAGCACGGGGAACACGACACGGACCTTGTCGTAGAAGCCTGC
GTAGTGGAAGGCCTCGGTCGGACTCATAAACACACTGGCGCCGTGGAACGGTTGCGGCGCCTGCCGCAGCACACGC